List of oligonucleotides according to the level of sequence conservation

The table describes different measures of sequence conservation for each oligonucleotide:
-PIS: percentage of identical sites
-3'PIS: percentage of identical sites in the last five nucleotides at the 3' end of oligonucleotide
-PPI: percentage of pairwise identity
-CoV2ID score: mean value of PIS, 3'PIS and PPI
The mean values were obtained considering Alig01 and Alig02 alignments in the database.

Database reference Target Original name Sequence (5-3) Position in reference genome Genomic region Mean PIS Mean 3PIS Mean PPI CoV2ID score Detection protocols
Database reference Target Original name Sequence (5-3) Position in reference genome Genomic region Mean PIS Mean 3PIS Mean PPI CoV2ID score Detection protocols
CoV2ID001
Raw data
Min-max
PCR primer forward China_CDC_Meta1_F CCCTGTGGGTTTTACACTTAA 13342-13362 ORF1ab 100 100 100 100 1
CoV2ID002
Raw data
Min-max
PCR primer reverse China_CDC_Meta1_R ACGATTGTGCATCAGCTGA 13442-13460 ORF1ab 94.73 90 99.9 94.88 1
CoV2ID003
Raw data
Min-max
Probe China_CDC_Meta1_P CCGTCTGCGGTATGTGGAAAGGTTATGG 13377-13404 ORF1ab 92.86 90 99.88 94.25 1
CoV2ID004
Raw data
Min-max
PCR primer forward China_CDC_Meta2_F GGGGAACTTCTCCTGCTAGAAT 28881-28902 N 72.72 90 98.25 86.99 1
CoV2ID005
Raw data
Min-max
PCR primer reverse China_CDC_Meta2_R CAGACATTTTGCTCTCAAGCTG 28958-28979 N 90.91 100 99.98 96.96 1
CoV2ID006
Raw data
Min-max
Probe China_CDC_Meta2_P TTGCTGCTGCTTGACAGATT 28934-28953 N 100 100 100 100 1
CoV2ID007
Raw data
Min-max
PCR primer forward Charite_RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG 15431-15452 ORF1ab 95.45 90 100 95.15 2
CoV2ID008
Raw data
Min-max
PCR primer reverse Charite_RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA 15505-15530 ORF1ab 100 100 100 100 2
CoV2ID009
Raw data
Min-max
Probe Charite_RdRP_SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 15470-15494 ORF1ab 96 100 100 98.67 2
CoV2ID010
Raw data
Min-max
Probe Charite_RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 15469-15494 ORF1ab 96.16 100 100 98.72 2
CoV2ID011
Raw data
Min-max
PCR primer forward Charite_E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 26269-26294 E 96.16 100 100 98.72 2
CoV2ID012
Raw data
Min-max
PCR primer reverse Charite_E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 26360-26381 E 97.72 100 100 99.24 2
CoV2ID013
Raw data
Min-max
Probe Charite_E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 26332-26357 E 90.39 70 99.96 86.78 2
CoV2ID014
Raw data
Min-max
PCR primer forward HKU-ORF1b-nsp14F TGGGGYTTTACRGGTAACCT 18778-18797 ORF1ab 45 40 99.03 61.34 3
CoV2ID015
Raw data
Min-max
PCR primer reverse HKU- ORF1b-nsp14R AACRCGCTTAACAAAGCACTC 18889-18909 ORF1b-nsp15 40.48 50 99.05 63.17 3
CoV2ID016
Raw data
Min-max
Probe HKU-ORF1b-nsp141P TAGTTGTGATGCWATCATGACTAG 18849-18872 ORF1b-nsp16 47.91 50 99.06 65.66 3
CoV2ID017
Raw data
Min-max
PCR primer forward HKU-NF TAATCAGACAAGGAACTGATTA 29145-29166 N 97.72 100 99.97 99.23 3
CoV2ID018
Raw data
Min-max
PCR primer reverse HKU-NR CGAAGGTGTGACTTCCATG 29236-29254 N 86.84 80 99.97 88.94 3
CoV2ID019
Raw data
Min-max
Probe HKU-NP GCAAATTGTGCAATTTGCGG 29177-29196 N 95 100 100 98.33 3
CoV2ID020
Raw data
Min-max
PCR primer forward WH-NIC N-F CGTTTGGTGGACCCTCAGAT 28320-28339 N 92.5 100 100 97.5 4
CoV2ID021
Raw data
Min-max
PCR primer reverse WH-NIC N-R CCCCACTGCGTTCTCCATT 28358-28376 N 86.84 100 99.94 95.59 4
CoV2ID022
Raw data
Min-max
Probe WH-NIC N-P CAACTGGCAGTAACCA 28341-28356 N 96.88 100 99.98 98.95 4
CoV2ID023
Raw data
Min-max
PCR primer forward NIID_WH-1_F501 TTCGGATGCTCGAACTGCACC 484-504 ORF1ab 45.24 50 98.91 64.72 5
CoV2ID024
Raw data
Min-max
PCR primer reverse NIID_WH-1_R913 CTTTACCAGCACGTGCTAGAAGG 874-896 ORF1ab 93.48 80 99.97 91.15 5
CoV2ID025
Raw data
Min-max
PCR primer forward NIID_WH-1_F509 CTCGAACTGCACCTCATGG 492-510 ORF1ab 47.37 40 98.77 62.04 5
CoV2ID026
Raw data
Min-max
PCR primer reverse NIID_WH-1_R854 CAGAAGTTGTTATCGACATAGC 816-837 ORF1ab 93.18 100 99.97 97.71 5
CoV2ID027
Raw data
Min-max
PCR primer forward NIID_WH-1_Seq_F519 ACCTCATGGTCATGTTATGG 502-521 ORF1ab 30 10 97.6 45.87 5
CoV2ID028
Raw data
Min-max
PCR primer reverse NIID_WH-1_Seq_R840 GACATAGCGAGTGTATGCC 805-823 ORF1ab 97.37 100 100 99.12 5
CoV2ID029
Raw data
Min-max
PCR primer forward WuhanCoV-spk1-f TTGGCAAAATTCAAGACTCACTTT 24354-24377 S 36 40 99.03 58.34 5
CoV2ID030
Raw data
Min-max
PCR primer reverse WuhanCoV-spk2-r TGTGGTTCATAAAAATTCCTTTGTG 24876-24900 S 48 50 99.06 65.69 5
CoV2ID031
Raw data
Min-max
PCR primer forward NIID_WH-1_F24381 TCAAGACTCACTTTCTTCCAC 24364-24384 S 26.19 10 98.97 45.05 5
CoV2ID032
Raw data
Min-max
PCR primer reverse NIID_WH-1_R24873 ATTTGAAACAAAGACACCTTCAC 24834-24856 S 45.65 40 99.05 61.57 5
CoV2ID033
Raw data
Min-max
PCR primer forward NIID_WH-1_Seq_F24383 AAGACTCACTTTCTTCCACAG 24366-24386 S 28.57 30 98.97 52.51 5
CoV2ID034
Raw data
Min-max
PCR primer reverse NIID_WH-1_Seq_R24865 CAAAGACACCTTCACGAGG 24830-24848 S 44.73 40 99.05 61.26 5
CoV2ID035
Raw data
Min-max
PCR primer forward NIID_2019-nCOV_N_F2 AAATTTTGGGGACCAGGAAC 29125-29144 N 95 80 99.98 91.66 5
CoV2ID036
Raw data
Min-max
PCR primer reverse NIID_2019-nCOV_N_R2 TGGCAGCTGTGTAGGTCAAC 29263-29282 N 87.5 90 99.99 92.5 5
CoV2ID037
Raw data
Min-max
Probe NIID_2019-nCOV_N_P2 ATGTCGCGCATTGGCATGGA 29222-29241 N 82.5 80 99.94 87.48 5
CoV2ID038
Raw data
Min-max
PCR primer forward CDC_2019-nCoV_N1-F GACCCCAAAATCAGCGAAAT 28287-28306 N 83.34 90 99.98 91.11 6
CoV2ID039
Raw data
Min-max
PCR primer reverse CDC_2019-nCoV_N1-R TCTGGTTACTGCCAGTTGAATCTG 28335-28358 N 95.84 100 99.99 98.61 6
CoV2ID040
Raw data
Min-max
Probe CDC_2019-nCoV_N1-P ACCCCGCATTACGTTTGGTGGACC 28309-28332 N 89.59 80 99.95 89.85 6
CoV2ID041
Raw data
Min-max
PCR primer forward CDC_2019-nCoV_N2-F TTACAAACATTGGCCGCAAA 29164-29183 N 95 90 100 95 6
CoV2ID042
Raw data
Min-max
PCR primer reverse CDC_2019-nCoV_N2-R GCGCGACATTCCGAAGAA 29213-29230 N 88.88 100 99.94 96.28 6
CoV2ID043
Raw data
Min-max
Probe CDC_2019-nCoV_N2-P ACAATTTGCCCCCAGCGCTTCAG 29188-29210 N 93.48 100 100 97.83 6
CoV2ID044
Raw data
Min-max
PCR primer forward CDC_2019-nCoV_N3-F GGGAGCCTTGAATACACCAAAA 28681-28702 N 93.18 100 99.91 97.7 6
CoV2ID045
Raw data
Min-max
PCR primer reverse CDC_2019-nCoV_N3-R TGTAGCACGATTGCAGCATTG 28732-28752 N 92.85 100 99.99 97.62 6
CoV2ID046
Raw data
Min-max
Probe CDC_2019-nCoV_N3-P AYCACATTGGCACCCGCAATCCTG 28704-28727 N 88.63 80 99.99 89.54 6
CoV2ID047
Raw data
Min-max
PCR primer forward Pasteur_nCoV_IP2-12669Fw ATGAGCTTAGTCCTGTTG 12690-12707 ORF1ab 100 100 100 100 7
CoV2ID048
Raw data
Min-max
PCR primer reverse Pasteur_nCoV_IP2-12759Rv CTCCCTTTGTTGTGTTGT 12780-12797 ORF1ab 91.66 90 99.97 93.88 7
CoV2ID049
Raw data
Min-max
Probe Pasteur_nCoV_IP2-12696bProbe AGATGTCTTGTGCTGCCGGTA 12717-12737 ORF1ab 97.62 100 100 99.21 7
CoV2ID050
Raw data
Min-max
PCR primer forward Pasteur_nCoV_IP4-14059Fw GGTAACTGGTATGATTTCG 14080-14098 ORF1ab 100 100 100 100 7
CoV2ID051
Raw data
Min-max
PCR primer reverse Pasteur_nCoV_IP4-14146Rv CTGGTCAAGGTTAATATAGG 14167-14186 ORF1ab 97.5 100 100 99.17 7
CoV2ID052
Raw data
Min-max
Probe Pasteur_nCoV_IP4-14084Probe TCATACAAACCACGCCAGG 14105-14123 ORF1ab 92.1 80 100 90.7 7
CoV2ID053
Raw data
Min-max
PCR primer forward RBD-qF1 CAATGGTTTAACAGGCACAGG 23191 - 23211 S 47.5 50 99.06 65.52 8
CoV2ID054
Raw data
Min-max
PCR primer reverse RBD-qR1 CTCAAGTGTCTGTGGATCACG 23291 - 23311 S 100 100 100 100 8
CoV2ID055
Raw data
Min-max
PCR primer forward ND-CoVs-951F TGTKAGRTTYCCTAAYATTAC 22540 - 22560 S 50 50 98.67 66.22 8
CoV2ID056
Raw data
Min-max
PCR primer reverse D-CoVs-1805R ACATCYTGATANARAACAGC 23387 - 23406 S 90 100 98.71 96.24 8
CoV2ID057
Raw data
Min-max
PCR primer forward nCoV_2019 Forward CAAATTCTATGGTGGTTGGCACA 15216 - 15238 ORF1ab 47.83 40 99.06 62.29 9
CoV2ID058
Raw data
Min-max
PCR primer reverse nCoV_2019 Reverse GGCATGGCTCTATCACATTTAGG 15298 - 15320 ORF1ab 50 50 99.06 66.35 9
CoV2ID059
Raw data
Min-max
Probe CoV_Probe ATAATCCCAACCCATRAG 15280 - 15297 ORF1ab 50 50 99.06 66.35 9
CoV2ID060
Raw data
Min-max
Target Generation N-gene-FWD IVT AATTCTAATACGACTCACTATAGGGCCAAA(...) 28519 - 28545 N 96.3 100 100 98.76 10
CoV2ID061
Raw data
Min-max
Target Generation N-gene-REV IVT CACAGTTTGCTGTTTCTTCTGTCTCTGCGG 29420 - 29449 N 40.33 30 98.12 56.15 10
CoV2ID062
Raw data
Min-max
Target Generation E-gene-FWD IVT AATTCTAATACGACTCACTATAGGGCTGGT(...) 26060 - 26088 E 94.83 90 99.98 94.94 10
CoV2ID063
Raw data
Min-max
Target Generation E-gene-REV IVT CCTATTACTAGGTTCCATTGTTC 26574 - 26596 E 97.83 100 100 99.27 10
CoV2ID064
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV N-gene AACACAAGCTTTCGGCAG 29083 - 29100 N 94.44 100 99.76 98.07 10
CoV2ID065
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV N-gene GAAATTTGGATCTTTGTCATCC 29290 - 29311 N 84.09 90 99.85 91.31 10
CoV2ID066
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV N-gene TGCGGCCAATGTTTGTAATCAGCCAAGGAA(...) 29119 - 29137 N 95.45 100 100 98.48 10
CoV2ID067
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV N-gene CGCATTGGCATGGAAGTCACTTTGATGGCA(...) 29269 - 29287 N 82.5 90 99.94 90.81 10
CoV2ID068
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV N-gene TTCCTTGTCTGATTAGTTC 29141 - 29159 N 94.73 100 99.95 98.23 10
CoV2ID069
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV N-gene ACCTTCGGGAACGTGGTT 29248 - 29265 N 91.66 100 99.98 97.21 10
CoV2ID070
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV E-gene CCGACGACGACTACTAGC 26191 - 26208 E 77.78 100 99.78 92.52 10
CoV2ID071
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV E-gene AGAGTAAACGTAAAAAGAAGGTT 26402 - 26424 E 95.65 100 100 98.55 10
CoV2ID072
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV E-gene ACCTGTCTCTTCCGAAACGAATTTGTAAGC(...) 26214 - 26233 E 88.63 90 100 92.88 10
CoV2ID073
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV E-gene CTAGCCATCCTTACTGCGCTACTCACGTTA(...) 26374 - 26394 E 100 100 100 100 10
CoV2ID074
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV E-gene TCGATTGTGTGCGTACTGC 26355 - 26373 E 97.37 90 100 95.79 10
CoV2ID075
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV E-gene TGAGTACATAAGTTCGTAC 26235 - 26253 E 100 100 100 100 10
CoV2ID076
Raw data
Min-max
PCR primer forward N_Sarbeco_F CACATTGGCACCCGCAATC 28706 - 28724 N 92.1 100 99.99 97.37 11
CoV2ID077
Raw data
Min-max
PCR primer reverse N_Sarbeco_R GAGGAACGAGAAGAGGCTTG 28814 - 28833 N 87.5 90 99.97 92.49 11
CoV2ID078
Raw data
Min-max
Probe N_Sarbeco_P ACTTCCTCAAGGAACAACATTGCCA 28753 - 28777 N 98 100 100 99.33 11
CoV2ID079
Raw data
Min-max
PCR primer forward nsp2f ATGCATTTGCATCAGAGGCT 1866 - 1885 ORF1ab 97.5 90 100 95.83 12
CoV2ID080
Raw data
Min-max
PCR primer reverse nsp2r TTGTTATAGCGGCCTTCTGT 1951 - 1970 ORF1ab 91.66 100 99.84 97.17 12
CoV2ID081
Raw data
Min-max
PCR primer forward N_gene_Taq1 TCTGGTAAAGGCCAACAACAA 28976 - 28996 N 95.24 100 99.98 98.41 13
CoV2ID082
Raw data
Min-max
PCR primer reverse N_gene_Taq2 TGTATGCTTTAGTGGCAGTACG 29057 - 29078 N 97.72 100 100 99.24 13
CoV2ID083
Raw data
Min-max
Probe N_gene_Probe CTGTCACTAAGAAATCTGCTGCTGAGGC 29007 - 29034 N 89.28 100 99.99 96.42 13
CoV2ID084
Raw data
Min-max
PCR primer forward orf1ab-F CAGACCTCGTCTATGCTTTAAGGC 13814 - 13837 ORF1ab 97.91 90 100 95.97 14
CoV2ID085
Raw data
Min-max
PCR primer reverse orf1ab-R CCCTGGTCAAGGTTAATATAGGCA 14165 - 14188 ORF1ab 97.91 100 100 99.3 14
CoV2ID086
Raw data
Min-max
PCR primer forward S-F CTTCCCTCAGTCAGCACCTC 24715 - 24734 S 100 100 100 100 14
CoV2ID087
Raw data
Min-max
PCR primer reverse S-R AACCAGTGTGTGCCATTTGA 24815 - 24870 S 45 50 98.98 64.66 14
CoV2ID088
Raw data
Min-max
LAMP outer forward primer orf1ab-4F3 GGTATGATTTTGTAGAAAACCCA 13925 - 13947 ORF1ab 93.75 90 99.97 94.57 14
CoV2ID089
Raw data
Min-max
LAMP outer backward primer orf1ab-4B3 CAACAGGAACTCCACTACC 14122 - 14140 ORF1ab 97.37 90 100 95.79 14
CoV2ID090
Raw data
Min-max
LAMP forward inner primer orf1ab-4FIP GGCATCACAGAATTGTACTGTTTTTGCGTA(...) 13958 - 13976 ORF1ab 98 100 100 99.33 14
CoV2ID091
Raw data
Min-max
LAMP backward inner primer orf1ab-4BIP AATGCTGGTATTGTTGGTGTACTGAGGTTT(...) 14095 - 14115 ORF1ab 96 90 99.96 95.32 14
CoV2ID092
Raw data
Min-max
LAMP loop forward primer orf1ab-4LF AACAAAGCTTGGCGTACACGTTCA 13977 - 14000 ORF1ab 97.91 90 100 95.97 14
CoV2ID093
Raw data
Min-max
LAMP outer forward primer S-123F3 TCTATTGCCATACCCACAA 23693 - 23711 S 47.37 40 99.05 62.14 14
CoV2ID094
Raw data
Min-max
LAMP outer backward primer S-123B3 GGTGTTTTGTAAATTTGTTTGAC 23915 - 23937 S 43.48 50 99.01 64.16 14
CoV2ID095
Raw data
Min-max
LAMP forward inner primer S-123FIP CATTCAGTTGAATCACCACAAATGTGTGTT(...) 23724 - 23745 S 50 50 98.13 66.04 14
CoV2ID096
Raw data
Min-max
LAMP backward inner primer S-123BIP GTTGCAATATGGCAGTTTTTGTACATTGGG(...) 23880 - 23899 S 50 50 99.06 66.35 14
CoV2ID097
Raw data
Min-max
LAMP loop forward primer S-123LF ACTGATGTCTTGGTCATAGACACT 23746 - 23769 S 45.84 50 98.12 64.65 14
CoV2ID098
Raw data
Min-max
LAMP loop backward primer S-123LB TAAACCGTGCTTTAACTGGAATAGC 23850 - 23874 S 44 40 99.05 61.02 14
CoV2ID099
Raw data
Min-max
PCR primer forward Chan_S_gene_F CCTACTAAATTAAATGATCTCTGCTTTACT 22712 - 22741 S 48.34 50 99.06 65.8 15
CoV2ID100
Raw data
Min-max
PCR primer reverse Chan_S_gene_R CAAGCTATAACGCAGCCTGTA 22849 - 22869 S 38.09 50 99.05 62.38 15
CoV2ID101
Raw data
Min-max
PCR primer forward Chan_RdRp_gene_F CAAGTGGGGTAAGGCTAGACTTT 14965 - 14983 ORF1ab 50 50 99.06 66.35 15
CoV2ID102
Raw data
Min-max
PCR primer reverse Chan_RdRp_gene_R ACTTAGGATAATCCCAACCCAT 15283 - 15302 ORF1ab 50 50 99.06 66.35 15
CoV2ID103
Raw data
Min-max
PCR primer forward Caly_BetaCoV_RdRp_F AAATTCTATGGTGGTTGGCACAACATGTT 15217 - 15245 ORF1ab 46.55 50 99.06 65.2 16
CoV2ID104
Raw data
Min-max
PCR primer reverse Caly_BetaCoV_RdRp_R TAGGCATAGCTCTRTCACAYTT 15301 - 15322 ORF1ab 50 50 99.06 66.35 16
CoV2ID105
Raw data
Min-max
Probe Caly_BetaCoV_RdRp_P TGGGTTGGGATTATC 15284 - 15298 ORF1ab 50 50 99.06 66.35 16
CoV2ID106
Raw data
Min-max
PCR primer forward Huang_E_gene_F ACTTCTTTTTCTTGCTTTCGTGGT 26295 - 26318 E 95.84 100 100 98.61 17
CoV2ID107
Raw data
Min-max
PCR primer reverse Huang_E_gene_R GCAGCAGTACGCACACAATC 26357 - 26376 E 97.5 100 100 99.17 17
CoV2ID108
Raw data
Min-max
Probe Huang_E_gene_P CTAGTTACACTAGCCATCCTTACTGC 26326 - 26351 E 92.31 90 99.92 94.08 17
CoV2ID109
Raw data
Min-max
PCR primer forward Lu_orf1ab_F AGAAGATTGGTTAGATGATGATAGT 3193 - 3217 ORF1ab 50 50 99.06 66.35 18
CoV2ID110
Raw data
Min-max
PCR primer reverse Lu_orf1ab_R TTCCATCTCTAATTGAGGTTGAACC 3286 - 3310 ORF1ab 96 90 100 95.33 18
CoV2ID111
Raw data
Min-max
Probe Lu_orf1ab_P TCCTCACTGCCGTCTTGTTGACCA 3229 - 3252 ORF1ab 54.16 70 99.13 74.43 18
CoV2ID112
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV N1-gene TGGACCCCAAAATCAGCG 28285 - 28302 N 84.21 90 99.99 91.4 19
CoV2ID113
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV N1-gene GCCTTGTCCTCGAGGGAAT 28468 - 28486 N 94.73 90 100 94.91 19
CoV2ID114
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV N1-gene CCACTGCGTTCTCCATTCTGGTAAATGCAC(...) 28303 - 28321 N 88.63 80 99.95 89.53 19
CoV2ID115
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV N1-gene CGCGATCAAAACAACGTCGGCCCTTGCCAT(...) 28438 - 28457 N 91.31 70 99.91 87.07 19
CoV2ID116
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV N1-gene TGAATCTGAGGGTCCACCAAA 28322 - 28342 N 90.47 90 100 93.49 19
CoV2ID117
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV N1-gene GGTTTACCCAATAATACTGCGTCTT 28403 - 28427 N 96 100 99.96 98.65 19
CoV2ID118
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV N15-gene AGATCACATTGGCACCCG 28702 - 28719 N 91.66 90 99.99 93.88 19
CoV2ID119
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV N15-gene CCATTGCCAGCCATTCTAGC 28895 - 28914 N 75 80 99.98 84.99 19
CoV2ID120
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV N15-gene TGCTCCCTTCTGCGTAGAAGCCAATGCTGC(...) 28732 - 28751 N 90.91 90 99.94 93.62 19
CoV2ID121
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV N15-gene GGCGGCAGTCAAGCCTCTTCCCTACTGCTG(...) 28864 - 28883 N 90 90 99.98 93.33 19
CoV2ID122
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV N15-gene GCAATGTTGTTCCTTGAGGAAGTT 28752 - 28775 N 97.91 100 100 99.3 19
CoV2ID123
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV N15-gene GTTCCTCATCACGTAGTCGCAACA 28827 - 28850 N 77.09 80 99.94 85.68 19
CoV2ID124
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV S17-gene TCTTTCACACGTGGTGTT 21653 - 21670 S 47.22 50 99.06 65.42 19
CoV2ID125
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV S17-gene GTACCAAAAATCCAGCCTC 21867 - 21885 S 47.37 50 99.06 65.48 19
CoV2ID126
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV S17-gene CATGGAACCAAGTAACATTGGAAAACCTGA(...) 21677 - 21697 S 46 50 99.05 65.02 19
CoV2ID127
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV S17-gene CTCTGGGACCAATGGTACTAAGAGGACTTC(...) 21838 - 21855 S 38 30 99.05 55.68 19
CoV2ID128
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV S17-gene GAAAGGTAAGAACAAGTCCTGAGT 21713 - 21736 S 45.84 50 99.05 64.96 19
CoV2ID129
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV S17-gene CTGTCCTACCATTTAATGATGGTGT 21807 - 21831 S 42 40 99.05 60.35 19
CoV2ID130
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV O117-gene CCCCAAAATGCTGTTGTT 1346 - 1363 ORF1ab 94.44 100 100 98.15 19
CoV2ID131
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV O117-gene TAGCACGTGGAACCCAAT 1530 - 1547 ORF1ab 50 50 99.06 66.35 19
CoV2ID132
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV O117-gene GGTTTTCAAGCCAGATTCATTATGGATGTC(...) 1381 - 1402 ORF1ab 38 50 99.02 62.34 19
CoV2ID133
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV O117-gene TCTTCGTAAGGGTGGTCGCAGCACACTTGT(...) 1509 - 1527 ORF1ab 42.5 40 99.05 60.52 19
CoV2ID134
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV O117-gene TCGGCAAGACTATGCTCAGG 1403 - 1422 ORF1ab 45 50 99.05 64.68 19
CoV2ID135
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV O117-gene TTGCCTTTGGAGGCTGTGT 1476 - 1494 ORF1ab 44.73 50 99.05 64.59 19
CoV2ID136
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV orf1ab-gene AAACGTAATGTCATCCCTACT 15034 - 15054 ORF1ab 50 50 99.06 66.35 20
CoV2ID137
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV orf1ab-gene ACTGTTTATAGTGATGTAGAAAACC 15250 - 15274 ORF1ab 46.16 50 99.06 65.07 20
CoV2ID138
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV orf1ab-gene ACAGATAGAGACACCAGCTACGGCTCAAAT(...) 15059 - 15082 ORF1ab 50 50 99.06 66.35 20
CoV2ID139
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV orf1ab-gene ATAGCCGCCACTAAGAGGAGCCCAACCACC(...) 15215 - 15234 ORF1ab 50 50 99.06 66.35 20
CoV2ID140
Raw data
Min-max
LAMP loop backward primer LF 2019-nCoV orf1ab-gene TTAGTGCAAAGAATAGAGCTCGCA 15083 - 15106 N 50 50 99.06 66.35 21
CoV2ID141
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV N-gene GCCAAAAGGCTTCTACGCA 28774 - 28792 N 92.1 80 99.94 90.68 21
CoV2ID142
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV N-gene TTGCTCTCAAGCTGGTTCAA 28952 - 28971 N 95 100 100 98.33 21
CoV2ID143
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV N-gene TCCCCTACTGCTGCCTGGAGCAGTCAAGCC(...) 28809 - 28829 N 88.09 80 99.98 89.36 21
CoV2ID144
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV N-gene TCTCCTGCTAGAATGGCTGGCATCTGTCAA(...) 28932 - 28952 N 79.55 100 99.98 93.17 21
CoV2ID145
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV N-gene TGGCGGTGATGCTGCTCTT 28912 - 28930 N 84.21 70 99.94 84.72 21