Database reference: CoV2ID127

Type of target: LAMP primer

Techniques: RT-LAMP

Target: backward inner primer

Original name: BIP 2019-nCoV S17-gene

Target length:

Amplicon length:

Sequence (5-3): CTCTGGGACCAATGGTACTAAGAGGACTTCTCAGTGGAAGCA

Position in reference genome: 21838 - 21855

Genomic region: S

Sequence in reference genome: TGCTTCCACTGAGAAGTC

Related image:

Detection protocols: