Database reference: CoV2ID014

Type of target: PCR primer

Techniques: RT-PCR

Target: PCR primer forward

Original name: HKU-ORF1b-nsp14F

Target length:

Amplicon length:

Sequence (5-3): TGGGGYTTTACRGGTAACCT

Position in reference genome: 18778-18797

Genomic region: ORF1b-nsp14

Sequence in reference genome: TGGGGTTTTACAGGTAACCT

Related image:

Detection protocols: