Database reference: CoV2ID007

Type of target: PCR primer

Techniques: RT-PCR

Target: PCR primer forward

Original name: Charite_RdRP_SARSr-F2

Target length:

Amplicon length:

Sequence (5-3): GTGARATGGTCATGTGTGGCGG

Position in reference genome: 15431-15452

Genomic region: ORF1ab

Sequence in reference genome: GTGAAATGGTCATGTGTGGCGG

Related image:

Detection protocols: