Database reference: CoV2ID012

Type of target: PCR primer

Techniques: RT-PCR

Target: PCR primer reverse

Original name: Charite_E_Sarbeco_R2

Target length:

Amplicon length:

Sequence (5-3): ATATTGCAGCAGTACGCACACA

Position in reference genome: 26360-26381

Genomic region: E

Sequence in reference genome: TGTGTGCGTACTGCTGCAATAT

Related image:

Detection protocols: