Complete list of oligonucleotides

The table describes all information for each oligonucleotide retrieved from peer-reviewed publications.

Click on the oligonucleotide reference number to open a separate page with additional information.

Database reference Type of target Techniques Target Original name Sequence (5-3) Position in reference genome Genomic region Sequence in reference genome Detection protocols
Database reference Type of target Techniques Target Original name Sequence (5-3) Position in reference genome Genomic region Sequence in reference genome Detection protocols
CoV2ID001 PCR primer RT-PCR PCR primer forward China_CDC_Meta1_F CCCTGTGGGTTTTACACTTAA 13342-13362 ORF1ab CCCTGTGGGTTTTACACTTAA 1
CoV2ID002 PCR primer RT-PCR PCR primer reverse China_CDC_Meta1_R ACGATTGTGCATCAGCTGA 13442-13460 ORF1ab TCAGCTGATGCACAATCGT 1
CoV2ID003 Probe RT-PCR Probe China_CDC_Meta1_P CCGTCTGCGGTATGTGGAAAGGTTATGG 13377-13404 ORF1ab CCGTCTGCGGTATGTGGAAAGGTTATGG 1
CoV2ID004 PCR primer RT-PCR PCR primer forward China_CDC_Meta2_F GGGGAACTTCTCCTGCTAGAAT 28881-28902 N GGGGAACTTCTCCTGCTAGAAT 1
CoV2ID005 PCR primer RT-PCR PCR primer reverse China_CDC_Meta2_R CAGACATTTTGCTCTCAAGCTG 28958-28979 N CAGCTTGAGAGCAAAATGTCTG 1
CoV2ID006 Probe RT-PCR Probe China_CDC_Meta2_P TTGCTGCTGCTTGACAGATT 28934-28953 N TTGCTGCTGCTTGACAGATT 1
CoV2ID007 PCR primer RT-PCR PCR primer forward Charite_RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG 15431-15452 ORF1ab GTGAAATGGTCATGTGTGGCGG 2
CoV2ID008 PCR primer RT-PCR PCR primer reverse Charite_RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA 15505-15530 ORF1ab TATGCTAATAGTGTTTTTAACATTTG 2
CoV2ID009 Probe RT-PCR Probe Charite_RdRP_SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 15470-15494 ORF1ab CAGGTGGAACCTCATCAGGAGATGC 2
CoV2ID010 Probe RT-PCR Probe Charite_RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 15469-15494 ORF1ab CCAGGTGGAACCTCATCAGGAGATGC 2
CoV2ID011 PCR primer RT-PCR PCR primer forward Charite_E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 26269-26294 E ACAGGTACGTTAATAGTTAATAGCGT 2
CoV2ID012 PCR primer RT-PCR PCR primer reverse Charite_E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 26360-26381 E TGTGTGCGTACTGCTGCAATAT 2
CoV2ID013 Probe RT-PCR Probe Charite_E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 26332-26357 E ACACTAGCCATCCTTACTGCGCTTCG 2
CoV2ID014 PCR primer RT-PCR PCR primer forward HKU-ORF1b-nsp14F TGGGGYTTTACRGGTAACCT 18778-18797 ORF1ab TGGGGTTTTACAGGTAACCT 3
CoV2ID015 PCR primer RT-PCR PCR primer reverse HKU- ORF1b-nsp14R AACRCGCTTAACAAAGCACTC 18889-18909 ORF1b-nsp15 GAGTGCTTTGTTAAGCGTGTT 3
CoV2ID016 Probe RT-PCR Probe HKU-ORF1b-nsp141P TAGTTGTGATGCWATCATGACTAG 18849-18872 ORF1b-nsp16 TAGTTGTGATGCAATCATGACTAG 3
CoV2ID017 PCR primer RT-PCR PCR primer forward HKU-NF TAATCAGACAAGGAACTGATTA 29145-29166 N TAATCAGACAAGGAACTGATTA 3
CoV2ID018 PCR primer RT-PCR PCR primer reverse HKU-NR CGAAGGTGTGACTTCCATG 29236-29254 N CATGGAAGTCACACCTTCG 3
CoV2ID019 Probe RT-PCR Probe HKU-NP GCAAATTGTGCAATTTGCGG 29177-29196 N CCGCAAATTGCACAATTTGC 3
CoV2ID020 PCR primer RT-PCR PCR primer forward WH-NIC N-F CGTTTGGTGGACCCTCAGAT 28320-28339 N CGTTTGGTGGACCCTCAGAT 4
CoV2ID021 PCR primer RT-PCR PCR primer reverse WH-NIC N-R CCCCACTGCGTTCTCCATT 28358-28376 N AATGGAGAACGCAGTGGGG 4
CoV2ID022 Probe RT-PCR Probe WH-NIC N-P CAACTGGCAGTAACCA 28341-28356 N CAACTGGCAGTAACCA 4
CoV2ID023 PCR primer Nested PCR PCR primer forward NIID_WH-1_F501 TTCGGATGCTCGAACTGCACC 484-504 ORF1ab TTCGGATGCTCGAACTGCACC 5
CoV2ID024 PCR primer Nested PCR PCR primer reverse NIID_WH-1_R913 CTTTACCAGCACGTGCTAGAAGG 874-896 ORF1ab CCTTCTAGCACGTGCTGGTAAAG 5
CoV2ID025 PCR primer Nested PCR PCR primer forward NIID_WH-1_F509 CTCGAACTGCACCTCATGG 492-510 ORF1ab CTCGAACTGCACCTCATGG 5
CoV2ID026 PCR primer Nested PCR PCR primer reverse NIID_WH-1_R854 CAGAAGTTGTTATCGACATAGC 816-837 ORF1ab GCTATGTCGATAACAACTTCTG 5
CoV2ID027 PCR primer Nested PCR PCR primer forward NIID_WH-1_Seq_F519 ACCTCATGGTCATGTTATGG 502-521 ORF1ab ACCTCATGGTCATGTTATGG 5
CoV2ID028 PCR primer Nested PCR PCR primer reverse NIID_WH-1_Seq_R840 GACATAGCGAGTGTATGCC 805-823 ORF1ab GGCATACACTCGCTATGTC 5
CoV2ID029 PCR primer Nested PCR PCR primer forward WuhanCoV-spk1-f TTGGCAAAATTCAAGACTCACTTT 24354-24377 S TTGGCAAAATTCAAGACTCACTTT 5
CoV2ID030 PCR primer Nested PCR PCR primer reverse WuhanCoV-spk2-r TGTGGTTCATAAAAATTCCTTTGTG 24876-24900 S CACAAAGGAATTTTTATGAACCACA 5
CoV2ID031 PCR primer Nested PCR PCR primer forward NIID_WH-1_F24381 TCAAGACTCACTTTCTTCCAC 24364-24384 S TCAAGACTCACTTTCTTCCAC 5
CoV2ID032 PCR primer Nested PCR PCR primer reverse NIID_WH-1_R24873 ATTTGAAACAAAGACACCTTCAC 24834-24856 S GTGAAGGTGTCTTTGTTTCAAAT 5
CoV2ID033 PCR primer Nested PCR PCR primer forward NIID_WH-1_Seq_F24383 AAGACTCACTTTCTTCCACAG 24366-24386 S AAGACTCACTTTCTTCCACAG 5
CoV2ID034 PCR primer Nested PCR PCR primer reverse NIID_WH-1_Seq_R24865 CAAAGACACCTTCACGAGG 24830-24848 S CCTCGTGAAGGTGTCTTTG 5
CoV2ID035 PCR primer RT-PCR PCR primer forward NIID_2019-nCOV_N_F2 AAATTTTGGGGACCAGGAAC 29125-29144 N AAATTTTGGGGACCAGGAAC 5
CoV2ID036 PCR primer RT-PCR PCR primer reverse NIID_2019-nCOV_N_R2 TGGCAGCTGTGTAGGTCAAC 29263-29282 N GTTGACCTACACAGGTGCCA 5
CoV2ID037 Probe RT-PCR Probe NIID_2019-nCOV_N_P2 ATGTCGCGCATTGGCATGGA 29222-29241 N ATGTCGCGCATTGGCATGGA 5
CoV2ID038 PCR primer RT-PCR PCR primer forward CDC_2019-nCoV_N1-F GACCCCAAAATCAGCGAAAT 28287-28306 N GACCCCAAAATCAGCGAAAT 6
CoV2ID039 PCR primer RT-PCR PCR primer reverse CDC_2019-nCoV_N1-R TCTGGTTACTGCCAGTTGAATCTG 28335-28358 N CAGATTCAACTGGCAGTAACCAGA 6
CoV2ID040 Probe RT-PCR Probe CDC_2019-nCoV_N1-P ACCCCGCATTACGTTTGGTGGACC 28309-28332 N ACCCCGCATTACGTTTGGTGGACC 6
CoV2ID041 PCR primer RT-PCR PCR primer forward CDC_2019-nCoV_N2-F TTACAAACATTGGCCGCAAA 29164-29183 N TTACAAACATTGGCCGCAAA 6
CoV2ID042 PCR primer RT-PCR PCR primer reverse CDC_2019-nCoV_N2-R GCGCGACATTCCGAAGAA 29213-29230 N TTCTTCGGAATGTCGCGC 6
CoV2ID043 Probe RT-PCR Probe CDC_2019-nCoV_N2-P ACAATTTGCCCCCAGCGCTTCAG 29188-29210 N ACAATTTGCCCCCAGCGCTTCAG 6
CoV2ID044 PCR primer RT-PCR PCR primer forward CDC_2019-nCoV_N3-F GGGAGCCTTGAATACACCAAAA 28681-28702 N GGGAGCCTTGAATACACCAAAA 6
CoV2ID045 PCR primer RT-PCR PCR primer reverse CDC_2019-nCoV_N3-R TGTAGCACGATTGCAGCATTG 28732-28752 N CAATGCTGCAATCGTGCTACA 6
CoV2ID046 Probe RT-PCR Probe CDC_2019-nCoV_N3-P AYCACATTGGCACCCGCAATCCTG 28704-28727 N ATCACATTGGCACCCGCAATCCTG 6
CoV2ID047 PCR primer RT-PCR PCR primer forward Pasteur_nCoV_IP2-12669Fw ATGAGCTTAGTCCTGTTG 12690-12707 ORF1ab ATGAGCTTAGTCCTGTTG 7
CoV2ID048 PCR primer RT-PCR PCR primer reverse Pasteur_nCoV_IP2-12759Rv CTCCCTTTGTTGTGTTGT 12780-12797 ORF1ab ACAACACAACAAAGGGAG 7
CoV2ID049 Probe RT-PCR Probe Pasteur_nCoV_IP2-12696bProbe AGATGTCTTGTGCTGCCGGTA 12717-12737 ORF1ab AGATGTCTTGTGCTGCCGGTA 7
CoV2ID050 PCR primer RT-PCR PCR primer forward Pasteur_nCoV_IP4-14059Fw GGTAACTGGTATGATTTCG 14080-14098 ORF1ab GGTAACTGGTATGATTTCG 7
CoV2ID051 PCR primer RT-PCR PCR primer reverse Pasteur_nCoV_IP4-14146Rv CTGGTCAAGGTTAATATAGG 14167-14186 ORF1ab CCTATATTAACCTTGACCAG 7
CoV2ID052 Probe RT-PCR Probe Pasteur_nCoV_IP4-14084Probe TCATACAAACCACGCCAGG 14105-14123 ORF1ab TCATACAAACCACGCCAGG 7
CoV2ID053 PCR primer RT-PCR PCR primer forward RBD-qF1 CAATGGTTTAACAGGCACAGG 23191 - 23211 S CAATGGTTTAACAGGCACAGG 8
CoV2ID054 PCR primer RT-PCR PCR primer reverse RBD-qR1 CTCAAGTGTCTGTGGATCACG 23291 - 23311 S CGTGATCCACAGACACTTGAG 8
CoV2ID055 PCR primer PCR PCR primer forward ND-CoVs-951F TGTKAGRTTYCCTAAYATTAC 22540 - 22560 S TGTTAGATTTCCTAATATTAC 8
CoV2ID056 PCR primer PCR PCR primer reverse D-CoVs-1805R ACATCYTGATANARAACAGC 23387 - 23406 S GCTGTTCTTTATCAGGATGT 8
CoV2ID057 PCR primer RT-PCR PCR primer forward nCoV_2019 Forward CAAATTCTATGGTGGTTGGCACA 15216 - 15238 ORF1ab CAAATTCTATGGTGGTTGGCACA 9
CoV2ID058 PCR primer RT-PCR PCR primer reverse nCoV_2019 Reverse GGCATGGCTCTATCACATTTAGG 15298 - 15320 ORF1ab CCTAAATGTGATAGAGCCATGCC 9
CoV2ID059 Probe RT-PCR Probe CoV_Probe ATAATCCCAACCCATRAG 15280 - 15297 ORF1ab CTTATGGGTTGGGATTAT 9
CoV2ID060 Target Generation primer Target Generation N-gene-FWD IVT AATTCTAATACGACTCACTATAGGGCCAAATTGGCTACTACCGAAGAGCTAC 28519 - 28545 N CCAAATTGGCTACTACCGAAGAGCTAC 10
CoV2ID061 Target Generation primer Target Generation N-gene-REV IVT CACAGTTTGCTGTTTCTTCTGTCTCTGCGG 29420 - 29449 N CCGCAGAGACAGAAGAAACAGCAAACTGTG 10
CoV2ID062 Target Generation primer Target Generation E-gene-FWD IVT AATTCTAATACGACTCACTATAGGGCTGGTGTTGAACATGTTACCTTCTTCATC 26060 - 26088 E CTGGTGTTGAACATGTTACCTTCTTCATC 10
CoV2ID063 Target Generation primer Target Generation E-gene-REV IVT CCTATTACTAGGTTCCATTGTTC 26574 - 26596 E GAACAATGGAACCTAGTAATAGG 10
CoV2ID064 LAMP primer LAMP outer forward primer F3 2019-nCoV N-gene AACACAAGCTTTCGGCAG 29083 - 29100 N AACACAAGCTTTCGGCAG 10
CoV2ID065 LAMP primer LAMP outer backward primer B3 2019-nCoV N-gene GAAATTTGGATCTTTGTCATCC 29290 - 29311 N GGATGACAAAGATCCAAATTTC 10
CoV2ID066 LAMP primer LAMP backward inner primer BIP 2019-nCoV N-gene TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC 29119 - 29137 N CCAAGGAAATTTTGGGGAC 10
CoV2ID067 LAMP primer LAMP forward inner primer FIP 2019-nCoV N-gene CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG 29269 - 29287 N CTACACAGGTGCCATCAAA 10
CoV2ID068 LAMP primer LAMP loop forward primer LF 2019-nCoV N-gene TTCCTTGTCTGATTAGTTC 29141 - 29159 N GAACTAATCAGACAAGGAA 10
CoV2ID069 LAMP primer LAMP loop backward primer LB 2019-nCoV N-gene ACCTTCGGGAACGTGGTT 29248 - 29265 N ACCTTCGGGAACGTGGTT 10
CoV2ID070 LAMP primer LAMP outer forward primer F3 2019-nCoV E-gene CCGACGACGACTACTAGC 26191 - 26208 E CCGACGACGACTACTAGC 10
CoV2ID071 LAMP primer LAMP outer backward primer B3 2019-nCoV E-gene AGAGTAAACGTAAAAAGAAGGTT 26402 - 26424 E AACCTTCTTTTTACGTTTACTCT 10
CoV2ID072 LAMP primer LAMP backward inner primer BIP 2019-nCoV E-gene ACCTGTCTCTTCCGAAACGAATTTGTAAGCACAAGCTGATG 26214 - 26233 E TTTGTAAGCACAAGCTGATG 10
CoV2ID073 LAMP primer LAMP forward inner primer FIP 2019-nCoV E-gene CTAGCCATCCTTACTGCGCTACTCACGTTAACAATATTGCA 26374 - 26394 E TGCAATATTGTTAACGTGAGT 10
CoV2ID074 LAMP primer LAMP loop forward primer LF 2019-nCoV E-gene TCGATTGTGTGCGTACTGC 26355 - 26373 E TCGATTGTGTGCGTACTGC 10
CoV2ID075 LAMP primer LAMP loop backward primer LB 2019-nCoV E-gene TGAGTACATAAGTTCGTAC 26235 - 26253 E GTACGAACTTATGTACTCA 10
CoV2ID076 PCR primer RT-PCR PCR primer forward N_Sarbeco_F CACATTGGCACCCGCAATC 28706 - 28724 N CACATTGGCACCCGCAATC 11
CoV2ID077 PCR primer RT-PCR PCR primer reverse N_Sarbeco_R GAGGAACGAGAAGAGGCTTG 28814 - 28833 N CAAGCCTCTTCTCGTTCCTC 11
CoV2ID078 Probe RT-PCR Probe N_Sarbeco_P ACTTCCTCAAGGAACAACATTGCCA 28753 - 28777 N ACTTCCTCAAGGAACAACATTGCCA 11
CoV2ID079 PCR primer RT-PCR PCR primer forward nsp2f ATGCATTTGCATCAGAGGCT 1866 - 1885 ORF1ab ATGCATTTGCATCAGAGGCT 12
CoV2ID080 PCR primer RT-PCR PCR primer reverse nsp2r TTGTTATAGCGGCCTTCTGT 1951 - 1970 ORF1ab ACAGAAGGCCGCTATAACAA 12
CoV2ID081 PCR primer RT-PCR PCR primer forward N_gene_Taq1 TCTGGTAAAGGCCAACAACAA 28976 - 28996 N TCTGGTAAAGGCCAACAACAA 13
CoV2ID082 PCR primer RT-PCR PCR primer reverse N_gene_Taq2 TGTATGCTTTAGTGGCAGTACG 29057 - 29078 N CGTACTGCCACTAAAGCATACA 13
CoV2ID083 Probe RT-PCR Probe N_gene_Probe CTGTCACTAAGAAATCTGCTGCTGAGGC 29007 - 29034 N CTGTCACTAAGAAATCTGCTGCTGAGGC 13
CoV2ID084 PCR primer PCR PCR primer forward orf1ab-F CAGACCTCGTCTATGCTTTAAGGC 13814 - 13837 ORF1ab CAGACCTCGTCTATGCTTTAAGGC 14
CoV2ID085 PCR primer PCR PCR primer reverse orf1ab-R CCCTGGTCAAGGTTAATATAGGCA 14165 - 14188 ORF1ab TGCCTATATTAACCTTGACCAGGG 14
CoV2ID086 PCR primer PCR PCR primer forward S-F CTTCCCTCAGTCAGCACCTC 24715 - 24734 S CTTCCCTCAGTCAGCACCTC 14
CoV2ID087 PCR primer PCR PCR primer reverse S-R AACCAGTGTGTGCCATTTGA 24815 - 24870 S TCAAATGGCACACACTGGTT 14
CoV2ID088 LAMP primer RT-LAMP outer forward primer orf1ab-4F3 GGTATGATTTTGTAGAAAACCCA 13925 - 13947 ORF1ab GGTATGATTTTGTAGAAAACCCA 14
CoV2ID089 LAMP primer RT-LAMP outer backward primer orf1ab-4B3 CAACAGGAACTCCACTACC 14122 - 14140 ORF1ab GGTAGTGGAGTTCCTGTTG 14
CoV2ID090 LAMP primer RT-LAMP forward inner primer orf1ab-4FIP GGCATCACAGAATTGTACTGTTTTTGCGTATACGCCAACTTAGG 13958 - 13976 ORF1ab GCGTATACGCCAACTTAGG 14
CoV2ID091 LAMP primer RT-LAMP backward inner primer orf1ab-4BIP AATGCTGGTATTGTTGGTGTACTGAGGTTTGTATGAAATCACCGAA 14095 - 14115 ORF1ab TTCGGTGATTTCATACAAACC 14
CoV2ID092 LAMP primer RT-LAMP loop forward primer orf1ab-4LF AACAAAGCTTGGCGTACACGTTCA 13977 - 14000 ORF1ab TGAACGTGTACGCCAAGCTTTGTT 14
CoV2ID093 LAMP primer RT-LAMP outer forward primer S-123F3 TCTATTGCCATACCCACAA 23693 - 23711 S TCTATTGCCATACCCACAA 14
CoV2ID094 LAMP primer RT-LAMP outer backward primer S-123B3 GGTGTTTTGTAAATTTGTTTGAC 23915 - 23937 S GTCAAACAAATTTACAAAACACC 14
CoV2ID095 LAMP primer RT-LAMP forward inner primer S-123FIP CATTCAGTTGAATCACCACAAATGTGTGTTACCACAGAAATTCTACC 23724 - 23745 S GTGTTACCACAGAAATTCTACC 14
CoV2ID096 LAMP primer RT-LAMP backward inner primer S-123BIP GTTGCAATATGGCAGTTTTTGTACATTGGGTGTTTTTGTCTTGTT 23880 - 23899 S AACAAGACAAAAACACCCAA 14
CoV2ID097 LAMP primer RT-LAMP loop forward primer S-123LF ACTGATGTCTTGGTCATAGACACT 23746 - 23769 S AGTGTCTATGACCAAGACATCAGT 14
CoV2ID098 LAMP primer RT-LAMP loop backward primer S-123LB TAAACCGTGCTTTAACTGGAATAGC 23850 - 23874 S TAAACCGTGCTTTAACTGGAATAGC 14
CoV2ID099 PCR primer RT-PCR PCR primer forward Chan_S_gene_F CCTACTAAATTAAATGATCTCTGCTTTACT 22712 - 22741 S CCTACTAAATTAAATGATCTCTGCTTTACT 15
CoV2ID100 PCR primer RT-PCR PCR primer reverse Chan_S_gene_R CAAGCTATAACGCAGCCTGTA 22849 - 22869 S TACAGGCTGCGTTATAGCTTG 15
CoV2ID101 PCR primer RT-PCR PCR primer forward Chan_RdRp_gene_F CAAGTGGGGTAAGGCTAGACTTT 14965 - 14983 ORF1ab TGGGGTAAGGCTAGACTTT 15
CoV2ID102 PCR primer RT-PCR PCR primer reverse Chan_RdRp_gene_R ACTTAGGATAATCCCAACCCAT 15283 - 15302 ORF1ab ATGGGTTGGGATTATCCTAA 15
CoV2ID103 PCR primer RT-PCR PCR primer forward Caly_BetaCoV_RdRp_F AAATTCTATGGTGGTTGGCACAACATGTT 15217 - 15245 ORF1ab AAATTCTATGGTGGTTGGCACAACATGTT 16
CoV2ID104 PCR primer RT-PCR PCR primer reverse Caly_BetaCoV_RdRp_R TAGGCATAGCTCTRTCACAYTT 15301 - 15322 ORF1ab AAATGTGATAGAGCCATGCCTA 16
CoV2ID105 Probe RT-PCR Probe Caly_BetaCoV_RdRp_P TGGGTTGGGATTATC 15284 - 15298 ORF1ab TGGGTTGGGATTATC 16
CoV2ID106 PCR primer RT-PCR PCR primer forward Huang_E_gene_F ACTTCTTTTTCTTGCTTTCGTGGT 26295 - 26318 E ACTTCTTTTTCTTGCTTTCGTGGT 17
CoV2ID107 PCR primer RT-PCR PCR primer reverse Huang_E_gene_R GCAGCAGTACGCACACAATC 26357 - 26376 E GATTGTGTGCGTACTGCTGC 17
CoV2ID108 Probe RT-PCR Probe Huang_E_gene_P CTAGTTACACTAGCCATCCTTACTGC 26326 - 26351 E CTAGTTACACTAGCCATCCTTACTGC 17
CoV2ID109 PCR primer RT-PCR PCR primer forward Lu_orf1ab_F AGAAGATTGGTTAGATGATGATAGT 3193 - 3217 ORF1ab AGAAGATTGGTTAGATGATGATAGT 18
CoV2ID110 PCR primer RT-PCR PCR primer reverse Lu_orf1ab_R TTCCATCTCTAATTGAGGTTGAACC 3286 - 3310 ORF1ab GGTTCAACCTCAATTAGAGATGGAA 18
CoV2ID111 Probe RT-PCR Probe Lu_orf1ab_P TCCTCACTGCCGTCTTGTTGACCA 3229 - 3252 ORF1ab TGGTCAACAAGACGGCAGTGAGGA 18
CoV2ID112 LAMP primer RT-LAMP outer forward primer F3 2019-nCoV N1-gene TGGACCCCAAAATCAGCG 28285 - 28302 N TGGACCCCAAAATCAGCG 19
CoV2ID113 LAMP primer RT-LAMP outer backward primer B3 2019-nCoV N1-gene GCCTTGTCCTCGAGGGAAT 28468 - 28486 N ATTCCCTCGAGGACAAGGC 19
CoV2ID114 LAMP primer RT-LAMP forward inner primer FIP 2019-nCoV N1-gene CCACTGCGTTCTCCATTCTGGTAAATGCACCCCGCATTACG 28303 - 28321 N AATGCACCCCGCATTACG 19
CoV2ID115 LAMP primer RT-LAMP backward inner primer BIP 2019-nCoV N1-gene CGCGATCAAAACAACGTCGGCCCTTGCCATGTTGAGTGAGA 28438 - 28457 N TCTCACTCAACATGGCAAGG 19
CoV2ID116 LAMP primer RT-LAMP loop forward primer LF 2019-nCoV N1-gene TGAATCTGAGGGTCCACCAAA 28322 - 28342 N TTTGGTGGACCCTCAGATTCA 19
CoV2ID117 LAMP primer RT-LAMP loop backward primer LB 2019-nCoV N1-gene GGTTTACCCAATAATACTGCGTCTT 28403 - 28427 N GGTTTACCCAATAATACTGCGTCTT 19
CoV2ID118 LAMP primer RT-LAMP outer forward primer F3 2019-nCoV N15-gene AGATCACATTGGCACCCG 28702 - 28719 N AGATCACATTGGCACCCG 19
CoV2ID119 LAMP primer RT-LAMP outer backward primer B3 2019-nCoV N15-gene CCATTGCCAGCCATTCTAGC 28895 - 28914 N GCTAGAATGGCTGGCAATGG 19
CoV2ID120 LAMP primer RT-LAMP forward inner primer FIP 2019-nCoV N15-gene TGCTCCCTTCTGCGTAGAAGCCAATGCTGCAATCGTGCTAC 28732 - 28751 N CAATGCTGCAATCGTGCTAC 19
CoV2ID121 LAMP primer RT-LAMP backward inner primer BIP 2019-nCoV N15-gene GGCGGCAGTCAAGCCTCTTCCCTACTGCTGCCTGGAGTT 28864 - 28883 N AACTCCAGGCAGCAGTAGGG 19
CoV2ID122 LAMP primer RT-LAMP loop forward primer LF 2019-nCoV N15-gene GCAATGTTGTTCCTTGAGGAAGTT 28752 - 28775 N AACTTCCTCAAGGAACAACATTGC 19
CoV2ID123 LAMP primer RT-LAMP loop backward primer LB 2019-nCoV N15-gene GTTCCTCATCACGTAGTCGCAACA 28827 - 28850 N GTTCCTCATCACGTAGTCGCAACA 19
CoV2ID124 LAMP primer RT-LAMP outer forward primer F3 2019-nCoV S17-gene TCTTTCACACGTGGTGTT 21653 - 21670 S TCTTTCACACGTGGTGTT 19
CoV2ID125 LAMP primer RT-LAMP outer backward primer B3 2019-nCoV S17-gene GTACCAAAAATCCAGCCTC 21867 - 21885 S GAGGCTGGATTTTTGGTAC 19
CoV2ID126 LAMP primer RT-LAMP forward inner primer FIP 2019-nCoV S17-gene CATGGAACCAAGTAACATTGGAAAACCTGACAAAGTTTTCAGATCC 21677 - 21697 S CCTGACAAAGTTTTCAGATCC 19
CoV2ID127 LAMP primer RT-LAMP backward inner primer BIP 2019-nCoV S17-gene CTCTGGGACCAATGGTACTAAGAGGACTTCTCAGTGGAAGCA 21838 - 21855 S TGCTTCCACTGAGAAGTC 19
CoV2ID128 LAMP primer RT-LAMP loop forward primer LF 2019-nCoV S17-gene GAAAGGTAAGAACAAGTCCTGAGT 21713 - 21736 S ACTCAGGACTTGTTCTTACCTTTC 19
CoV2ID129 LAMP primer RT-LAMP loop backward primer LB 2019-nCoV S17-gene CTGTCCTACCATTTAATGATGGTGT 21807 - 21831 S CTGTCCTACCATTTAATGATGGTGT 19
CoV2ID130 LAMP primer RT-LAMP outer forward primer F3 2019-nCoV O117-gene CCCCAAAATGCTGTTGTT 1346 - 1363 ORF1ab CCCCAAAATGCTGTTGTT 19
CoV2ID131 LAMP primer RT-LAMP outer backward primer B3 2019-nCoV O117-gene TAGCACGTGGAACCCAAT 1530 - 1547 ORF1ab ATTGGGTTCCACGTGCTA 19
CoV2ID132 LAMP primer RT-LAMP forward inner primer FIP 2019-nCoV O117-gene GGTTTTCAAGCCAGATTCATTATGGATGTCACAATTCAGAAGTAGGA 1381 - 1402 ORF1ab TGTCACAATTCAGAAGTAGGA 19
CoV2ID133 LAMP primer RT-LAMP backward inner primer BIP 2019-nCoV O117-gene TCTTCGTAAGGGTGGTCGCAGCACACTTGTTATGGCAAC 1509 - 1527 ORF1ab GTTGCCATAACAAGTGTGC 19
CoV2ID134 LAMP primer RT-LAMP loop forward primer LF 2019-nCoV O117-gene TCGGCAAGACTATGCTCAGG 1403 - 1422 ORF1ab CCTGAGCATAGTCTTGCCGA 19
CoV2ID135 LAMP primer RT-LAMP loop backward primer LB 2019-nCoV O117-gene TTGCCTTTGGAGGCTGTGT 1476 - 1494 ORF1ab TTGCCTTTGGAGGCTGTGT 19
CoV2ID136 LAMP primer RT-LAMP outer forward primer F3 2019-nCoV orf1ab-gene AAACGTAATGTCATCCCTACT 15034 - 15054 ORF1ab AAACGTAATGTCATCCCTACT 20
CoV2ID137 LAMP primer RT-LAMP outer backward primer B3 2019-nCoV orf1ab-gene ACTGTTTATAGTGATGTAGAAAACC 15250 - 15274 ORF1ab ACTGTTTATAGTGATGTAGAAAACC 20
CoV2ID138 LAMP primer RT-LAMP forward inner primer FIP 2019-nCoV orf1ab-gene ACAGATAGAGACACCAGCTACGGCTCAAATGAATCTTAAGTATGCCA 15059 - 15082 ORF1ab CTCAAATGAATCTTAAGTATGCCA 20
CoV2ID139 LAMP primer RT-LAMP backward inner primer BIP 2019-nCoV orf1ab-gene ATAGCCGCCACTAAGAGGAGCCCAACCACCATAGAATTTGC 15215 - 15234 ORF1ab CAAATTCTATGGTGGTTGG 20
CoV2ID140 LAMP primer RT-LAMP loop backward primer LF 2019-nCoV orf1ab-gene TTAGTGCAAAGAATAGAGCTCGCA 15083 - 15106 N TTAGTGCAAAGAATAGAGCTCGCA 21
CoV2ID141 LAMP primer RT-LAMP outer forward primer F3 2019-nCoV N-gene GCCAAAAGGCTTCTACGCA 28774 - 28792 N GCCAAAAGGCTTCTACGCA 21
CoV2ID142 LAMP primer RT-LAMP outer backward primer B3 2019-nCoV N-gene TTGCTCTCAAGCTGGTTCAA 28952 - 28971 N TTGAACCAGCTTGAGAGCAA 21
CoV2ID143 LAMP primer RT-LAMP forward inner primer FIP 2019-nCoV N-gene TCCCCTACTGCTGCCTGGAGCAGTCAAGCCTCTTCTCGTT 28809 - 28829 N GCAGTCAAGCCTCTTCTCGTT 21
CoV2ID144 LAMP primer RT-LAMP backward inner primer BIP 2019-nCoV N-gene TCTCCTGCTAGAATGGCTGGCATCTGTCAAGCAGCAGCAAAG 28932 - 28952 N CTTTGCTGCTGCTTGACAGAT 21
CoV2ID145 LAMP primer RT-LAMP loop backward primer LB 2019-nCoV N-gene TGGCGGTGATGCTGCTCTT 28912 - 28930 N TGGCGGTGATGCTGCTCTT 21