Database reference: CoV2ID072

Type of target: LAMP primer

Techniques: LAMP

Target: backward inner primer

Original name: BIP 2019-nCoV E-gene

Target length:

Amplicon length:

Sequence (5-3): ACCTGTCTCTTCCGAAACGAATTTGTAAGCACAAGCTGATG

Position in reference genome: 26214 - 26233

Genomic region: E

Sequence in reference genome: TTTGTAAGCACAAGCTGATG

Related image:

Detection protocols: