Database reference: CoV2ID051

Type of target: PCR primer

Techniques: RT-PCR

Target: PCR primer reverse

Original name: Pasteur_nCoV_IP4-14146Rv

Target length:

Amplicon length:

Sequence (5-3): CTGGTCAAGGTTAATATAGG

Position in reference genome: 14167-14186

Genomic region: RdRp

Sequence in reference genome: CCTATATTAACCTTGACCAG

Related image:

Detection protocols: