Search for the best oligonucleotides according to the degree of conservation in specific sequence alignments


The table describes for each oligonucleotide different measures of sequence conservation for Alig01 and Alig02 alignments used in the database:
-PIS: percentage of identical sites
-3'PIS: percentage of identical sites in the last five nucleotides at the 3' end of oligonucleotide
-PPI: percentage of pairwise identity
-CoV2ID score: mean value of PIS, 3'PIS and PPI
-POS: Position in alignment.

Alig01 Alig02
Database reference Target Original name Sequence (5-3) Position in reference genome Genomic region Sequence in reference genome POS CoV2ID score POS CoV2ID score Detection protocols
Database reference Target Original name Sequence (5-3) Position in reference genome Genomic region Sequence in reference genome POS CoV2ID score POS CoV2ID score Detection protocols
CoV2ID001
Raw data
Min-max
PCR primer forward China_CDC_Meta1_F CCCTGTGGGTTTTACACTTAA 13342-13362 ORF1ab CCCTGTGGGTTTTACACTTAA 4349-4358 100.00 4510-4519 100.00 1
CoV2ID002
Raw data
Min-max
PCR primer reverse China_CDC_Meta1_R ACGATTGTGCATCAGCTGA 13442-13460 ORF1ab TCAGCTGATGCACAATCGT 13492-13510 89.76 14294-14312 100.00 1
CoV2ID003
Raw data
Min-max
Probe China_CDC_Meta1_P CCGTCTGCGGTATGTGGAAAGGTTATGG 13377-13404 ORF1ab CCGTCTGCGGTATGTGGAAAGGTTATGG 13427-13454 97.58 14229-14256 90.92 1
CoV2ID004
Raw data
Min-max
PCR primer forward China_CDC_Meta2_F GGGGAACTTCTCCTGCTAGAAT 28881-28902 N GGGGAACTTCTCCTGCTAGAAT 28952-28973 100.00 31163-31184 73.98 1
CoV2ID005
Raw data
Min-max
PCR primer reverse China_CDC_Meta2_R CAGACATTTTGCTCTCAAGCTG 28958-28979 N CAGCTTGAGAGCAAAATGTCTG 29029-29050 100.00 31240-31261 93.93 1
CoV2ID006
Raw data
Min-max
Probe China_CDC_Meta2_P TTGCTGCTGCTTGACAGATT 28934-28953 N TTGCTGCTGCTTGACAGATT 29005-29024 100.00 31216-31235 100.00 1
CoV2ID007
Raw data
Min-max
PCR primer forward Charite_RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG 15431-15452 ORF1ab GTGAAATGGTCATGTGTGGCGG 15481-15502 100.00 16285-16306 90.30 2
CoV2ID008
Raw data
Min-max
PCR primer reverse Charite_RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA 15505-15530 ORF1ab TATGCTAATAGTGTTTTTAACATTTG 15555-15580 100.00 16359-16384 100.00 2
CoV2ID009
Raw data
Min-max
Probe Charite_RdRP_SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 15470-15494 ORF1ab CAGGTGGAACCTCATCAGGAGATGC 15520-15544 100.00 16324-16348 97.33 2
CoV2ID010
Raw data
Min-max
Probe Charite_RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 15469-15494 ORF1ab CCAGGTGGAACCTCATCAGGAGATGC 15519-15544 100.00 16323-16348 97.44 2
CoV2ID011
Raw data
Min-max
PCR primer forward Charite_E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 26269-26294 E ACAGGTACGTTAATAGTTAATAGCGT 26340-26365 100.00 28077-28102 97.44 2
CoV2ID012
Raw data
Min-max
PCR primer reverse Charite_E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 26360-26381 E TGTGTGCGTACTGCTGCAATAT 26431-26452 100.00 28168-28189 98.48 2
CoV2ID013
Raw data
Min-max
Probe Charite_E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 26332-26357 E ACACTAGCCATCCTTACTGCGCTTCG 26403-26428 92.03 28140-28165 81.54 2
CoV2ID014
Raw data
Min-max
PCR primer forward HKU-ORF1b-nsp14F TGGGGYTTTACRGGTAACCT 18778-18797 ORF1ab TGGGGTTTTACAGGTAACCT 18841-18860 32.70 20000-20019 89.99 3
CoV2ID015
Raw data
Min-max
PCR primer reverse HKU- ORF1b-nsp14R AACRCGCTTAACAAAGCACTC 18889-18909 ORF1b-nsp15 GAGTGCTTTGTTAAGCGTGTT 18952-18972 32.70 20111-20131 93.65 3
CoV2ID016
Raw data
Min-max
Probe HKU-ORF1b-nsp141P TAGTTGTGATGCWATCATGACTAG 18849-18872 ORF1b-nsp16 TAGTTGTGATGCAATCATGACTAG 18912-18935 32.70 20071-20094 98.61 3
CoV2ID017
Raw data
Min-max
PCR primer forward HKU-NF TAATCAGACAAGGAACTGATTA 29145-29166 N TAATCAGACAAGGAACTGATTA 29216-29237 100.00 31428-31449 98.47 3
CoV2ID018
Raw data
Min-max
PCR primer reverse HKU-NR CGAAGGTGTGACTTCCATG 29236-29254 N CATGGAAGTCACACCTTCG 29307-29325 100.00 31519-31537 77.88 3
CoV2ID019
Raw data
Min-max
Probe HKU-NP GCAAATTGTGCAATTTGCGG 29177-29196 N CCGCAAATTGCACAATTTGC 29248-29267 100.00 31460-31479 96.66 3
CoV2ID020
Raw data
Min-max
PCR primer forward WH-NIC N-F CGTTTGGTGGACCCTCAGAT 28320-28339 N CGTTTGGTGGACCCTCAGAT 28391-28410 100.00 30447-30466 95.00 4
CoV2ID021
Raw data
Min-max
PCR primer reverse WH-NIC N-R CCCCACTGCGTTCTCCATT 28358-28376 N AATGGAGAACGCAGTGGGG 28429-28447 98.21 30485-30503 92.98 4
CoV2ID022
Raw data
Min-max
Probe WH-NIC N-P CAACTGGCAGTAACCA 28341-28356 N CAACTGGCAGTAACCA 28412-28427 100.00 30468-30483 97.91 4
CoV2ID023
Raw data
Min-max
PCR primer forward NIID_WH-1_F501 TTCGGATGCTCGAACTGCACC 484-504 ORF1ab TTCGGATGCTCGAACTGCACC 496-516 32.65 640-660 96.79 5
CoV2ID024
Raw data
Min-max
PCR primer reverse NIID_WH-1_R913 CTTTACCAGCACGTGCTAGAAGG 874-896 ORF1ab CCTTCTAGCACGTGCTGGTAAAG 886-908 100.00 1030-1052 82.30 5
CoV2ID025
Raw data
Min-max
PCR primer forward NIID_WH-1_F509 CTCGAACTGCACCTCATGG 492-510 ORF1ab CTCGAACTGCACCTCATGG 504-522 32.51 648-666 91.58 5
CoV2ID026
Raw data
Min-max
PCR primer reverse NIID_WH-1_R854 CAGAAGTTGTTATCGACATAGC 816-837 ORF1ab GCTATGTCGATAACAACTTCTG 828-849 100.00 972-993 95.43 5
CoV2ID027
Raw data
Min-max
PCR primer forward NIID_WH-1_Seq_F519 ACCTCATGGTCATGTTATGG 502-521 ORF1ab ACCTCATGGTCATGTTATGG 514-533 31.82 658-677 59.92 5
CoV2ID028
Raw data
Min-max
PCR primer reverse NIID_WH-1_Seq_R840 GACATAGCGAGTGTATGCC 805-823 ORF1ab GGCATACACTCGCTATGTC 817-835 100.00 961-979 98.25 5
CoV2ID029
Raw data
Min-max
PCR primer forward WuhanCoV-spk1-f TTGGCAAAATTCAAGACTCACTTT 24354-24377 S TTGGCAAAATTCAAGACTCACTTT 24425-24448 32.70 26126-26150 83.99 5
CoV2ID030
Raw data
Min-max
PCR primer reverse WuhanCoV-spk2-r TGTGGTTCATAAAAATTCCTTTGTG 24876-24900 S CACAAAGGAATTTTTATGAACCACA 24947-24971 32.70 26649-26673 98.67 5
CoV2ID031
Raw data
Min-max
PCR primer forward NIID_WH-1_F24381 TCAAGACTCACTTTCTTCCAC 24364-24384 S TCAAGACTCACTTTCTTCCAC 24435-24455 32.67 26137-26157 57.43 5
CoV2ID032
Raw data
Min-max
PCR primer reverse NIID_WH-1_R24873 ATTTGAAACAAAGACACCTTCAC 24834-24856 S GTGAAGGTGTCTTTGTTTCAAAT 24905-24927 32.70 26607-26629 90.43 5
CoV2ID033
Raw data
Min-max
PCR primer forward NIID_WH-1_Seq_F24383 AAGACTCACTTTCTTCCACAG 24366-24386 S AAGACTCACTTTCTTCCACAG 24437-24457 32.67 26139-26159 72.36 5
CoV2ID034
Raw data
Min-max
PCR primer reverse NIID_WH-1_Seq_R24865 CAAAGACACCTTCACGAGG 24830-24848 S CCTCGTGAAGGTGTCTTTG 24901-24919 32.70 26603-26621 89.82 5
CoV2ID035
Raw data
Min-max
PCR primer forward NIID_2019-nCOV_N_F2 AAATTTTGGGGACCAGGAAC 29125-29144 N AAATTTTGGGGACCAGGAAC 29196-29215 100.00 31408-31427 83.32 5
CoV2ID036
Raw data
Min-max
PCR primer reverse NIID_2019-nCOV_N_R2 TGGCAGCTGTGTAGGTCAAC 29263-29282 N GTTGACCTACACAGGTGCCA 29334-29353 100.00 31546-31565 84.99 5
CoV2ID037
Raw data
Min-max
Probe NIID_2019-nCOV_N_P2 ATGTCGCGCATTGGCATGGA 29222-29241 N ATGTCGCGCATTGGCATGGA 29293-29312 98.30 31505-31524 76.66 5
CoV2ID038
Raw data
Min-max
PCR primer forward CDC_2019-nCoV_N1-F GACCCCAAAATCAGCGAAAT 28287-28306 N GACCCCAAAATCAGCGAAAT 28358-28377 100.00 30413-30433 82.21 6
CoV2ID039
Raw data
Min-max
PCR primer reverse CDC_2019-nCoV_N1-R TCTGGTTACTGCCAGTTGAATCTG 28335-28358 N CAGATTCAACTGGCAGTAACCAGA 28406-28429 100.00 30462-30485 97.22 6
CoV2ID040
Raw data
Min-max
Probe CDC_2019-nCoV_N1-P ACCCCGCATTACGTTTGGTGGACC 28309-28332 N ACCCCGCATTACGTTTGGTGGACC 28380-28403 100.00 30436-30459 79.69 6
CoV2ID041
Raw data
Min-max
PCR primer forward CDC_2019-nCoV_N2-F TTACAAACATTGGCCGCAAA 29164-29183 N TTACAAACATTGGCCGCAAA 29235-29254 100.00 31447-31466 90.00 6
CoV2ID042
Raw data
Min-max
PCR primer reverse CDC_2019-nCoV_N2-R GCGCGACATTCCGAAGAA 29213-29230 N TTCTTCGGAATGTCGCGC 29284-29301 98.11 31496-31513 94.44 6
CoV2ID043
Raw data
Min-max
Probe CDC_2019-nCoV_N2-P ACAATTTGCCCCCAGCGCTTCAG 29188-29210 N ACAATTTGCCCCCAGCGCTTCAG 29259-29281 100.00 31471-31493 95.65 6
CoV2ID044
Raw data
Min-max
PCR primer forward CDC_2019-nCoV_N3-F GGGAGCCTTGAATACACCAAAA 28681-28702 N GGGAGCCTTGAATACACCAAAA 28752-28773 100.00 30963-30984 95.39 6
CoV2ID045
Raw data
Min-max
PCR primer reverse CDC_2019-nCoV_N3-R TGTAGCACGATTGCAGCATTG 28732-28752 N CAATGCTGCAATCGTGCTACA 28803-28823 100.00 31014-31034 95.23 6
CoV2ID046
Raw data
Min-max
Probe CDC_2019-nCoV_N3-P AYCACATTGGCACCCGCAATCCTG 28704-28727 N ATCACATTGGCACCCGCAATCCTG 28777-28798 100.00 30988-31009 79.08 6
CoV2ID047
Raw data
Min-max
PCR primer forward Pasteur_nCoV_IP2-12669Fw ATGAGCTTAGTCCTGTTG 12690-12707 ORF1ab ATGAGCTTAGTCCTGTTG 12738-12755 100.00 13385-13402 100.00 7
CoV2ID048
Raw data
Min-max
PCR primer reverse Pasteur_nCoV_IP2-12759Rv CTCCCTTTGTTGTGTTGT 12780-12797 ORF1ab ACAACACAACAAAGGGAG 12828-12845 100.00 13475-13492 87.75 7
CoV2ID049
Raw data
Min-max
Probe Pasteur_nCoV_IP2-12696bProbe AGATGTCTTGTGCTGCCGGTA 12717-12737 ORF1ab AGATGTCTTGTGCTGCCGGTA 12765-12785 100.00 13412-13432 98.41 7
CoV2ID050
Raw data
Min-max
PCR primer forward Pasteur_nCoV_IP4-14059Fw GGTAACTGGTATGATTTCG 14080-14098 ORF1ab GGTAACTGGTATGATTTCG 14130-14148 100.00 14933-14951 100.00 7
CoV2ID051
Raw data
Min-max
PCR primer reverse Pasteur_nCoV_IP4-14146Rv CTGGTCAAGGTTAATATAGG 14167-14186 ORF1ab CCTATATTAACCTTGACCAG 14217-14236 100.00 15020-15039 98.33 7
CoV2ID052
Raw data
Min-max
Probe Pasteur_nCoV_IP4-14084Probe TCATACAAACCACGCCAGG 14105-14123 ORF1ab TCATACAAACCACGCCAGG 14155-14173 100.00 14958-14976 81.40 7
CoV2ID053
Raw data
Min-max
PCR primer forward RBD-qF1 CAATGGTTTAACAGGCACAGG 23191 - 23211 S CAATGGTTTAACAGGCACAGG 23262-23282 32.70 24962-24981 98.33 8
CoV2ID054
Raw data
Min-max
PCR primer reverse RBD-qR1 CTCAAGTGTCTGTGGATCACG 23291 - 23311 S CGTGATCCACAGACACTTGAG 23362-23382 100.00 25062-25082 100.00 8
CoV2ID055
Raw data
Min-max
PCR primer forward ND-CoVs-951F TGTKAGRTTYCCTAAYATTAC 22540 - 22560 S TGTTAGATTTCCTAATATTAC 22611-22631 32.45 24182-24202 100.00 8
CoV2ID056
Raw data
Min-max
PCR primer reverse D-CoVs-1805R ACATCYTGATANARAACAGC 23387 - 23406 S GCTGTTCTTTATCAGGATGT 23458-23477 98.27 25158-25177 94.20 8
CoV2ID057
Raw data
Min-max
PCR primer forward nCoV_2019 Forward CAAATTCTATGGTGGTTGGCACA 15216 - 15238 ORF1ab CAAATTCTATGGTGGTTGGCACA 15266-15288 32.70 16069-16091 91.88 9
CoV2ID058
Raw data
Min-max
PCR primer reverse nCoV_2019 Reverse GGCATGGCTCTATCACATTTAGG 15298 - 15320 ORF1ab CCTAAATGTGATAGAGCCATGCC 15348-15370 32.70 16152-16174 100.00 9
CoV2ID059
Raw data
Min-max
Probe CoV_Probe ATAATCCCAACCCATRAG 15280 - 15297 ORF1ab CTTATGGGTTGGGATTAT 15330-15347 32.70 16134-16151 100.00 9
CoV2ID060
Raw data
Min-max
Target Generation N-gene-FWD IVT AATTCTAATACGACTCACTATAGGGCCAAA(...) 28519 - 28545 N CCAAATTGGCTACTACCGAAGAGCTAC 28590-28616 100.00 30646-30672 97.53 10
CoV2ID061
Raw data
Min-max
Target Generation N-gene-REV IVT CACAGTTTGCTGTTTCTTCTGTCTCTGCGG 29420 - 29449 N CCGCAGAGACAGAAGAAACAGCAAACTGTG 29491-29520 32.09 31823-31853 80.21 10
CoV2ID062
Raw data
Min-max
Target Generation E-gene-FWD IVT AATTCTAATACGACTCACTATAGGGCTGGT(...) 26060 - 26088 E CTGGTGTTGAACATGTTACCTTCTTCATC 26131-26159 100.00 27868-27896 89.87 10
CoV2ID063
Raw data
Min-max
Target Generation E-gene-REV IVT CCTATTACTAGGTTCCATTGTTC 26574 - 26596 E GAACAATGGAACCTAGTAATAGG 26645-26667 100.00 28382-28404 98.55 10
CoV2ID064
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV N-gene AACACAAGCTTTCGGCAG 29083 - 29100 N AACACAAGCTTTCGGCAG 29154-29171 98.01 31366-31383 98.12 10
CoV2ID065
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV N-gene GAAATTTGGATCTTTGTCATCC 29290 - 29311 N GGATGACAAAGATCCAAATTTC 29361-29382 96.88 31573-31594 85.74 10
CoV2ID066
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV N-gene TGCGGCCAATGTTTGTAATCAGCCAAGGAA(...) 29119 - 29137 N CCAAGGAAATTTTGGGGAC 29231-29252 100.00 31443-31464 96.97 10
CoV2ID067
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV N-gene CGCATTGGCATGGAAGTCACTTTGATGGCA(...) 29269 - 29287 N CTACACAGGTGCCATCAAA 29299-29318 98.30 31511-31530 83.33 10
CoV2ID068
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV N-gene TTCCTTGTCTGATTAGTTC 29141 - 29159 N GAACTAATCAGACAAGGAA 29212-29230 100.00 31424-31442 96.46 10
CoV2ID069
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV N-gene ACCTTCGGGAACGTGGTT 29248 - 29265 N ACCTTCGGGAACGTGGTT 29319-29336 100.00 31531-31548 94.43 10
CoV2ID070
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV E-gene CCGACGACGACTACTAGC 26191 - 26208 E CCGACGACGACTACTAGC 26262-26279 92.45 27999-28016 92.59 10
CoV2ID071
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV E-gene AGAGTAAACGTAAAAAGAAGGTT 26402 - 26424 E AACCTTCTTTTTACGTTTACTCT 26473-26495 100.00 28210-28232 97.10 10
CoV2ID072
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV E-gene ACCTGTCTCTTCCGAAACGAATTTGTAAGC(...) 26214 - 26233 E TTTGTAAGCACAAGCTGATG 26324-26345 100.00 28061-28082 85.75 10
CoV2ID073
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV E-gene CTAGCCATCCTTACTGCGCTACTCACGTTA(...) 26374 - 26394 E TGCAATATTGTTAACGTGAGT 26445-26465 100.00 28182-28202 100.00 10
CoV2ID074
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV E-gene TCGATTGTGTGCGTACTGC 26355 - 26373 E TCGATTGTGTGCGTACTGC 26426-26444 100.00 28163-28181 91.58 10
CoV2ID075
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV E-gene TGAGTACATAAGTTCGTAC 26235 - 26253 E GTACGAACTTATGTACTCA 26306-26324 100.00 28043-28061 100.00 10
CoV2ID076
Raw data
Min-max
PCR primer forward N_Sarbeco_F CACATTGGCACCCGCAATC 28706 - 28724 N CACATTGGCACCCGCAATC 28777-28795 100.00 30988-31006 94.73 11
CoV2ID077
Raw data
Min-max
PCR primer reverse N_Sarbeco_R GAGGAACGAGAAGAGGCTTG 28814 - 28833 N CAAGCCTCTTCTCGTTCCTC 28885-28904 100.00 31096-31115 84.98 11
CoV2ID078
Raw data
Min-max
Probe N_Sarbeco_P ACTTCCTCAAGGAACAACATTGCCA 28753 - 28777 N ACTTCCTCAAGGAACAACATTGCCA 28824-28848 100.00 31035-31059 98.67 11
CoV2ID079
Raw data
Min-max
PCR primer forward nsp2f ATGCATTTGCATCAGAGGCT 1866 - 1885 ORF1ab ATGCATTTGCATCAGAGGCT 1902-1921 100.00 2049-2068 91.67 12
CoV2ID080
Raw data
Min-max
PCR primer reverse nsp2r TTGTTATAGCGGCCTTCTGT 1951 - 1970 ORF1ab ACAGAAGGCCGCTATAACAA 1987-1998 94.34 2134-2145 100.00 12
CoV2ID081
Raw data
Min-max
PCR primer forward N_gene_Taq1 TCTGGTAAAGGCCAACAACAA 28976 - 28996 N TCTGGTAAAGGCCAACAACAA 29047-29067 100.00 31258-31278 96.82 13
CoV2ID082
Raw data
Min-max
PCR primer reverse N_gene_Taq2 TGTATGCTTTAGTGGCAGTACG 29057 - 29078 N CGTACTGCCACTAAAGCATACA 29128-29149 100.00 31340-31361 98.48 13
CoV2ID083
Raw data
Min-max
Probe N_gene_Probe CTGTCACTAAGAAATCTGCTGCTGAGGC 29007 - 29034 N CTGTCACTAAGAAATCTGCTGCTGAGGC 29078-29105 100.00 31289-31316 92.85 13
CoV2ID084
Raw data
Min-max
PCR primer forward orf1ab-F CAGACCTCGTCTATGCTTTAAGGC 13814 - 13837 ORF1ab CAGACCTCGTCTATGCTTTAAGGC 13864-13887 100.00 14666-14689 91.94 14
CoV2ID085
Raw data
Min-max
PCR primer reverse orf1ab-R CCCTGGTCAAGGTTAATATAGGCA 14165 - 14188 ORF1ab TGCCTATATTAACCTTGACCAGGG 14215-14238 100.00 15018-15041 98.61 14
CoV2ID086
Raw data
Min-max
PCR primer forward S-F CTTCCCTCAGTCAGCACCTC 24715 - 24734 S CTTCCCTCAGTCAGCACCTC 24786-24805 100.00 26488-26507 100.00 14
CoV2ID087
Raw data
Min-max
PCR primer reverse S-R AACCAGTGTGTGCCATTTGA 24815 - 24870 S TCAAATGGCACACACTGGTT 24922-24941 32.70 26624-26643 96.62 14
CoV2ID088
Raw data
Min-max
LAMP outer forward primer orf1ab-4F3 GGTATGATTTTGTAGAAAACCCA 13925 - 13947 ORF1ab GGTATGATTTTGTAGAAAACCCA 13975-13997 100.00 14777-14800 89.15 14
CoV2ID089
Raw data
Min-max
LAMP outer backward primer orf1ab-4B3 CAACAGGAACTCCACTACC 14122 - 14140 ORF1ab GGTAGTGGAGTTCCTGTTG 14172-14190 100.00 14975-14993 91.58 14
CoV2ID090
Raw data
Min-max
LAMP forward inner primer orf1ab-4FIP GGCATCACAGAATTGTACTGTTTTTGCGTA(...) 13958 - 13976 ORF1ab GCGTATACGCCAACTTAGG 14051-14075 100.00 14854-14878 98.67 14
CoV2ID091
Raw data
Min-max
LAMP backward inner primer orf1ab-4BIP AATGCTGGTATTGTTGGTGTACTGAGGTTT(...) 14095 - 14115 ORF1ab TTCGGTGATTTCATACAAACC 14082-14106 98.64 14885-14909 92.00 14
CoV2ID092
Raw data
Min-max
LAMP loop forward primer orf1ab-4LF AACAAAGCTTGGCGTACACGTTCA 13977 - 14000 ORF1ab TGAACGTGTACGCCAAGCTTTGTT 14027-14050 100.00 14830-14853 91.94 14
CoV2ID093
Raw data
Min-max
LAMP outer forward primer S-123F3 TCTATTGCCATACCCACAA 23693 - 23711 S TCTATTGCCATACCCACAA 23764-23782 32.70 25464-25482 91.57 14
CoV2ID094
Raw data
Min-max
LAMP outer backward primer S-123B3 GGTGTTTTGTAAATTTGTTTGAC 23915 - 23937 S GTCAAACAAATTTACAAAACACC 23986-24008 32.70 25686-25708 95.62 14
CoV2ID095
Raw data
Min-max
LAMP forward inner primer S-123FIP CATTCAGTTGAATCACCACAAATGTGTGTT(...) 23724 - 23745 S GTGTTACCACAGAAATTCTACC 23855-23879 32.09 25555-25579 100.00 14
CoV2ID096
Raw data
Min-max
LAMP backward inner primer S-123BIP GTTGCAATATGGCAGTTTTTGTACATTGGG(...) 23880 - 23899 S AACAAGACAAAAACACCCAA 23892-23916 32.70 25592-25616 100.00 14
CoV2ID097
Raw data
Min-max
LAMP loop forward primer S-123LF ACTGATGTCTTGGTCATAGACACT 23746 - 23769 S AGTGTCTATGACCAAGACATCAGT 23817-23840 32.09 25517-25540 97.22 14
CoV2ID098
Raw data
Min-max
LAMP loop backward primer S-123LB TAAACCGTGCTTTAACTGGAATAGC 23850 - 23874 S TAAACCGTGCTTTAACTGGAATAGC 23921-23945 32.70 25621-25645 89.33 14
CoV2ID099
Raw data
Min-max
PCR primer forward Chan_S_gene_F CCTACTAAATTAAATGATCTCTGCTTTACT 22712 - 22741 S CCTACTAAATTAAATGATCTCTGCTTTACT 22783-22812 32.70 24382-24411 98.89 15
CoV2ID100
Raw data
Min-max
PCR primer reverse Chan_S_gene_R CAAGCTATAACGCAGCCTGTA 22849 - 22869 S TACAGGCTGCGTTATAGCTTG 22920-22940 32.70 24520-24540 92.06 15
CoV2ID101
Raw data
Min-max
PCR primer forward Chan_RdRp_gene_F CAAGTGGGGTAAGGCTAGACTTT 14965 - 14983 ORF1ab TGGGGTAAGGCTAGACTTT 15015-15033 32.70 15818-15836 100.00 15
CoV2ID102
Raw data
Min-max
PCR primer reverse Chan_RdRp_gene_R ACTTAGGATAATCCCAACCCAT 15283 - 15302 ORF1ab ATGGGTTGGGATTATCCTAA 15333-15352 32.70 16137-16156 100.00 15
CoV2ID103
Raw data
Min-max
PCR primer forward Caly_BetaCoV_RdRp_F AAATTCTATGGTGGTTGGCACAACATGTT 15217 - 15245 ORF1ab AAATTCTATGGTGGTTGGCACAACATGTT 15267-15295 32.70 16070-16098 97.70 16
CoV2ID104
Raw data
Min-max
PCR primer reverse Caly_BetaCoV_RdRp_R TAGGCATAGCTCTRTCACAYTT 15301 - 15322 ORF1ab AAATGTGATAGAGCCATGCCTA 15351-15372 32.70 16155-16176 100.00 16
CoV2ID105
Raw data
Min-max
Probe Caly_BetaCoV_RdRp_P TGGGTTGGGATTATC 15284 - 15298 ORF1ab TGGGTTGGGATTATC 15334-15348 32.70 16138-16152 100.00 16
CoV2ID106
Raw data
Min-max
PCR primer forward Huang_E_gene_F ACTTCTTTTTCTTGCTTTCGTGGT 26295 - 26318 E ACTTCTTTTTCTTGCTTTCGTGGT 26366-26389 100.00 28103-28126 97.22 17
CoV2ID107
Raw data
Min-max
PCR primer reverse Huang_E_gene_R GCAGCAGTACGCACACAATC 26357 - 26376 E GATTGTGTGCGTACTGCTGC 26428-26447 100.00 28165-28184 98.33 17
CoV2ID108
Raw data
Min-max
Probe Huang_E_gene_P CTAGTTACACTAGCCATCCTTACTGC 26326 - 26351 E CTAGTTACACTAGCCATCCTTACTGC 26397-26422 98.67 28134-28159 89.48 17
CoV2ID109
Raw data
Min-max
PCR primer forward Lu_orf1ab_F AGAAGATTGGTTAGATGATGATAGT 3193 - 3217 ORF1ab AGAAGATTGGTTAGATGATGATAGT 3235-3259 32.70 3395-3419 100.00 18
CoV2ID110
Raw data
Min-max
PCR primer reverse Lu_orf1ab_R TTCCATCTCTAATTGAGGTTGAACC 3286 - 3310 ORF1ab GGTTCAACCTCAATTAGAGATGGAA 3328-3352 100.00 3488-3512 90.67 18
CoV2ID111
Raw data
Min-max
Probe Lu_orf1ab_P TCCTCACTGCCGTCTTGTTGACCA 3229 - 3252 ORF1ab TGGTCAACAAGACGGCAGTGAGGA 3271-3294 48.87 3431-3454 100.00 18
CoV2ID112
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV N1-gene TGGACCCCAAAATCAGCG 28285 - 28302 N TGGACCCCAAAATCAGCG 28356-28373 100.00 30411-30429 82.80 19
CoV2ID113
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV N1-gene GCCTTGTCCTCGAGGGAAT 28468 - 28486 N ATTCCCTCGAGGACAAGGC 28539-28557 100.00 30595-30613 89.82 19
CoV2ID114
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV N1-gene CCACTGCGTTCTCCATTCTGGTAAATGCAC(...) 28303 - 28321 N AATGCACCCCGCATTACG 28424-28445 98.45 30480-30501 80.60 19
CoV2ID115
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV N1-gene CGCGATCAAAACAACGTCGGCCCTTGCCAT(...) 28438 - 28457 N TCTCACTCAACATGGCAAGG 28448-28470 91.83 30504-30526 82.32 19
CoV2ID116
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV N1-gene TGAATCTGAGGGTCCACCAAA 28322 - 28342 N TTTGGTGGACCCTCAGATTCA 28393-28413 100.00 30449-30469 86.98 19
CoV2ID117
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV N1-gene GGTTTACCCAATAATACTGCGTCTT 28403 - 28427 N GGTTTACCCAATAATACTGCGTCTT 28474-28498 98.64 30530-30554 98.67 19
CoV2ID118
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV N15-gene AGATCACATTGGCACCCG 28702 - 28719 N AGATCACATTGGCACCCG 28773-28790 100.00 30984-31001 87.77 19
CoV2ID119
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV N15-gene CCATTGCCAGCCATTCTAGC 28895 - 28914 N GCTAGAATGGCTGGCAATGG 28966-28985 100.00 31177-31196 69.99 19
CoV2ID120
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV N15-gene TGCTCCCTTCTGCGTAGAAGCCAATGCTGC(...) 28732 - 28751 N CAATGCTGCAATCGTGCTAC 28852-28873 98.45 31063-31084 88.78 19
CoV2ID121
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV N15-gene GGCGGCAGTCAAGCCTCTTCCCTACTGCTG(...) 28864 - 28883 N AACTCCAGGCAGCAGTAGGG 28876-28895 100.00 31087-31106 86.66 19
CoV2ID122
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV N15-gene GCAATGTTGTTCCTTGAGGAAGTT 28752 - 28775 N AACTTCCTCAAGGAACAACATTGC 28823-28846 100.00 31034-31057 98.61 19
CoV2ID123
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV N15-gene GTTCCTCATCACGTAGTCGCAACA 28827 - 28850 N GTTCCTCATCACGTAGTCGCAACA 28898-28921 100.00 31109-31132 71.35 19
CoV2ID124
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV S17-gene TCTTTCACACGTGGTGTT 21653 - 21670 S TCTTTCACACGTGGTGTT 21724-21741 32.70 23285-23302 98.15 19
CoV2ID125
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV S17-gene GTACCAAAAATCCAGCCTC 21867 - 21885 S GAGGCTGGATTTTTGGTAC 21938-21956 32.70 23499-23517 98.25 19
CoV2ID126
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV S17-gene CATGGAACCAAGTAACATTGGAAAACCTGA(...) 21677 - 21697 S CCTGACAAAGTTTTCAGATCC 21808-21832 32.70 23369-23393 97.33 19
CoV2ID127
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV S17-gene CTCTGGGACCAATGGTACTAAGAGGACTTC(...) 21838 - 21855 S TGCTTCCACTGAGAAGTC 21843-21867 32.70 23404-23428 78.66 19
CoV2ID128
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV S17-gene GAAAGGTAAGAACAAGTCCTGAGT 21713 - 21736 S ACTCAGGACTTGTTCTTACCTTTC 21784-21807 32.70 23345-23368 97.22 19
CoV2ID129
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV S17-gene CTGTCCTACCATTTAATGATGGTGT 21807 - 21831 S CTGTCCTACCATTTAATGATGGTGT 21878-21902 32.70 23439-23463 88.00 19
CoV2ID130
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV O117-gene CCCCAAAATGCTGTTGTT 1346 - 1363 ORF1ab CCCCAAAATGCTGTTGTT 1358-1375 100.00 1505-1522 96.29 19
CoV2ID131
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV O117-gene TAGCACGTGGAACCCAAT 1530 - 1547 ORF1ab ATTGGGTTCCACGTGCTA 1566-1583 32.70 1713-1730 100.00 19
CoV2ID132
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV O117-gene GGTTTTCAAGCCAGATTCATTATGGATGTC(...) 1381 - 1402 ORF1ab TGTCACAATTCAGAAGTAGGA 1462-1486 32.70 1609-1633 91.98 19
CoV2ID133
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV O117-gene TCTTCGTAAGGGTGGTCGCAGCACACTTGT(...) 1509 - 1527 ORF1ab GTTGCCATAACAAGTGTGC 1489-1508 32.70 1636-1655 88.33 19
CoV2ID134
Raw data
Min-max
LAMP loop forward primer LF 2019-nCoV O117-gene TCGGCAAGACTATGCTCAGG 1403 - 1422 ORF1ab CCTGAGCATAGTCTTGCCGA 1439-1458 32.70 1586-1605 96.66 19
CoV2ID135
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV O117-gene TTGCCTTTGGAGGCTGTGT 1476 - 1494 ORF1ab TTGCCTTTGGAGGCTGTGT 1512-1530 32.70 1659-1677 96.49 19
CoV2ID136
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV orf1ab-gene AAACGTAATGTCATCCCTACT 15034 - 15054 ORF1ab AAACGTAATGTCATCCCTACT 15084-15104 32.70 15887-15907 100.00 20
CoV2ID137
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV orf1ab-gene ACTGTTTATAGTGATGTAGAAAACC 15250 - 15274 ORF1ab ACTGTTTATAGTGATGTAGAAAACC 15300-15324 32.70 16103-16128 97.44 20
CoV2ID138
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV orf1ab-gene ACAGATAGAGACACCAGCTACGGCTCAAAT(...) 15059 - 15082 ORF1ab CTCAAATGAATCTTAAGTATGCCA 15109-15132 32.70 15912-15935 100.00 20
CoV2ID139
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV orf1ab-gene ATAGCCGCCACTAAGAGGAGCCCAACCACC(...) 15215 - 15234 ORF1ab CAAATTCTATGGTGGTTGG 15265-15284 32.70 16068-16087 100.00 20
CoV2ID140
Raw data
Min-max
LAMP loop backward primer LF 2019-nCoV orf1ab-gene TTAGTGCAAAGAATAGAGCTCGCA 15083 - 15106 N TTAGTGCAAAGAATAGAGCTCGCA 15133-15156 32.70 15936-15959 100.00 21
CoV2ID141
Raw data
Min-max
LAMP outer forward primer F3 2019-nCoV N-gene GCCAAAAGGCTTCTACGCA 28774 - 28792 N GCCAAAAGGCTTCTACGCA 28845-28863 91.55 31056-31074 89.82 21
CoV2ID142
Raw data
Min-max
LAMP outer backward primer B3 2019-nCoV N-gene TTGCTCTCAAGCTGGTTCAA 28952 - 28971 N TTGAACCAGCTTGAGAGCAA 29023-29042 100.00 31234-31253 96.66 21
CoV2ID143
Raw data
Min-max
LAMP forward inner primer FIP 2019-nCoV N-gene TCCCCTACTGCTGCCTGGAGCAGTCAAGCC(...) 28809 - 28829 N GCAGTCAAGCCTCTTCTCGTT 28880-28900 100.00 31091-31111 78.72 21
CoV2ID144
Raw data
Min-max
LAMP backward inner primer BIP 2019-nCoV N-gene TCTCCTGCTAGAATGGCTGGCATCTGTCAA(...) 28932 - 28952 N CTTTGCTGCTGCTTGACAGAT 28960-28981 100.00 31171-31192 86.35 21
CoV2ID145
Raw data
Min-max
LAMP loop backward primer LB 2019-nCoV N-gene TGGCGGTGATGCTGCTCTT 28912 - 28930 N TGGCGGTGATGCTGCTCTT 28983-29001 91.55 31194-31212 77.88 21