SARS-CoV-2 oligos in other human coronaviruses


False positives could be a problem when using PCR primers and probes due to binding in DNA non target species. SARS-CoV-2 oligos with a high divergence to other strains should be preferred.


Procedure used in Cov2ID to assess inter-strain diversity

CoV2ID_Other_CoV_procedure

Ranking of SARS-CoV-2 primer pairs according to their difference to other human coronaviruses. The lower the CoV2ID score, the lower the similarity of the oligo with other coronavirus genomes (i.e., less likely to bind).

Click on the oligonucleotide reference number to open a separate page with additional information.

Database reference Target Original name Sequence (5-3) Position in reference genome Genomic region Sequence in referencegenome POS PIS 3'PIS PPI CoV2ID score Detection protocols
Database reference Target Original name Sequence (5-3) Position in reference genome Genomic region Sequence in referencegenome POS PIS 3'PIS PPI CoV2ID score Detection protocols
CoV2ID001 PCR primer forward China_CDC_Meta1_F CCCTGTGGGTTTTACACTTAA 13342-13362 ORF1ab CCCTGTGGGTTTTACACTTAA 6626-6635 0 0 28.57 9.52 1
CoV2ID002 PCR primer reverse China_CDC_Meta1_R ACGATTGTGCATCAGCTGA 13442-13460 ORF1ab TCAGCTGATGCACAATCGT 16679-16697 10.53 0 51.63 20.72 1
CoV2ID003 Probe China_CDC_Meta1_P CCGTCTGCGGTATGTGGAAAGGTTATGG 13377-13404 ORF1ab CCGTCTGCGGTATGTGGAAAGGTTATGG 16604-16631 28.57 20 60.54 36.37 1
CoV2ID004 PCR primer forward China_CDC_Meta2_F GGGGAACTTCTCCTGCTAGAAT 28881-28902 N GGGGAACTTCTCCTGCTAGAAT 36660-36681 0 0 45.24 15.08 1
CoV2ID005 PCR primer reverse China_CDC_Meta2_R CAGACATTTTGCTCTCAAGCTG 28958-28979 N CAGCTTGAGAGCAAAATGTCTG 36746-36767 4.55 20 38.31 20.95 1
CoV2ID006 Probe China_CDC_Meta2_P TTGCTGCTGCTTGACAGATT 28934-28953 N TTGCTGCTGCTTGACAGATT 36714-36731 0 0 36.77 12.26 1
CoV2ID007 PCR primer forward Charite_RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG 15431-15452 ORF1ab GTGAAATGGTCATGTGTGGCGG 18688-18709 31.82 40 65.37 45.73 2
CoV2ID008 PCR primer reverse Charite_RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA 15505-15530 ORF1ab TATGCTAATAGTGTTTTTAACATTTG 18762-18787 57.69 60 80.22 65.97 2
CoV2ID009 Probe Charite_RdRP_SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 15470-15494 ORF1ab CAGGTGGAACCTCATCAGGAGATGC 18727-18751 52 80 73.14 68.38 2
CoV2ID010 Probe Charite_RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 15469-15494 ORF1ab CCAGGTGGAACCTCATCAGGAGATGC 18726-18751 53.85 80 74.18 69.34 2
CoV2ID011 PCR primer forward Charite_E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 26269-26294 E ACAGGTACGTTAATAGTTAATAGCGT 33931-33956 3.85 20 33.15 19 2
CoV2ID012 PCR primer reverse Charite_E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 26360-26381 E TGTGTGCGTACTGCTGCAATAT 34022-34043 18.18 80 49.35 49.18 2
CoV2ID013 Probe Charite_E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 26332-26357 E ACACTAGCCATCCTTACTGCGCTTCG 33994-34019 19.23 20 49.63 29.62 2
CoV2ID014 PCR primer forward HKU-ORF1b-nsp14F TGGGGYTTTACRGGTAACCT 18778-18797 ORF1ab TGGGGTTTTACAGGTAACCT 22057-22076 50 20 74.05 48.02 3
CoV2ID015 PCR primer reverse HKU- ORF1b-nsp14R AACRCGCTTAACAAAGCACTC 18889-18909 ORF1b-nsp15 GAGTGCTTTGTTAAGCGTGTT 22168-22188 38.1 40 68.48 48.86 3
CoV2ID016 Probe HKU-ORF1b-nsp141P TAGTTGTGATGCWATCATGACTAG 18849-18872 ORF1b-nsp16 TAGTTGTGATGCAATCATGACTAG 22128-22151 54.17 60 74.8 62.99 3
CoV2ID017 PCR primer forward HKU-NF TAATCAGACAAGGAACTGATTA 29145-29166 N TAATCAGACAAGGAACTGATTA 37013-37034 18.18 0 53.46 23.88 3
CoV2ID018 PCR primer reverse HKU-NR CGAAGGTGTGACTTCCATG 29236-29254 N CATGGAAGTCACACCTTCG 37104-37122 0 0 30.33 10.11 3
CoV2ID019 Probe HKU-NP GCAAATTGTGCAATTTGCGG 29177-29196 N CCGCAAATTGCACAATTTGC 37045-37064 40 20 66.19 42.06 3
CoV2ID020 PCR primer forward WH-NIC N-F CGTTTGGTGGACCCTCAGAT 28320-28339 N CGTTTGGTGGACCCTCAGAT 36078-36097 10 20 48.57 26.19 4
CoV2ID021 PCR primer reverse WH-NIC N-R CCCCACTGCGTTCTCCATT 28358-28376 N AATGGAGAACGCAGTGGGG 36116-36134 10.53 20 51.88 27.47 4
CoV2ID022 Probe WH-NIC N-P CAACTGGCAGTAACCA 28341-28356 N CAACTGGCAGTAACCA 36099-36114 6.25 0 41.07 15.77 4
CoV2ID023 PCR primer forward NIID_WH-1_F501 TTCGGATGCTCGAACTGCACC 484-504 ORF1ab TTCGGATGCTCGAACTGCACC 924-942 0 0 35.59 11.86 5
CoV2ID024 PCR primer reverse NIID_WH-1_R913 CTTTACCAGCACGTGCTAGAAGG 874-896 ORF1ab CCTTCTAGCACGTGCTGGTAAAG 1472-1494 13.04 0 50.93 21.32 5
CoV2ID025 PCR primer forward NIID_WH-1_F509 CTCGAACTGCACCTCATGG 492-510 ORF1ab CTCGAACTGCACCTCATGG 930-948 5.26 0 41.85 15.7 5
CoV2ID026 PCR primer reverse NIID_WH-1_R854 CAGAAGTTGTTATCGACATAGC 816-837 ORF1ab GCTATGTCGATAACAACTTCTG 1421-1435 0 0 40.95 13.65 5
CoV2ID027 PCR primer forward NIID_WH-1_Seq_F519 ACCTCATGGTCATGTTATGG 502-521 ORF1ab ACCTCATGGTCATGTTATGG 940-957 16.67 20 51.06 29.24 5
CoV2ID028 PCR primer reverse NIID_WH-1_Seq_R840 GACATAGCGAGTGTATGCC 805-823 ORF1ab GGCATACACTCGCTATGTC 1385-1402 5.56 0 48.68 18.08 5
CoV2ID029 PCR primer forward WuhanCoV-spk1-f TTGGCAAAATTCAAGACTCACTTT 24354-24377 S TTGGCAAAATTCAAGACTCACTTT 30628-30650 17.39 20 48.86 28.75 5
CoV2ID030 PCR primer reverse WuhanCoV-spk2-r TGTGGTTCATAAAAATTCCTTTGTG 24876-24900 S CACAAAGGAATTTTTATGAACCACA 31216-31240 16 20 51.24 29.08 5
CoV2ID031 PCR primer forward NIID_WH-1_F24381 TCAAGACTCACTTTCTTCCAC 24364-24384 S TCAAGACTCACTTTCTTCCAC 30638-30650 7.69 20 46.15 24.61 5
CoV2ID032 PCR primer reverse NIID_WH-1_R24873 ATTTGAAACAAAGACACCTTCAC 24834-24856 S GTGAAGGTGTCTTTGTTTCAAAT 31159-31177 10.53 0 52.63 21.05 5
CoV2ID033 PCR primer forward NIID_WH-1_Seq_F24383 AAGACTCACTTTCTTCCACAG 24366-24386 S AAGACTCACTTTCTTCCACAG 30640-30650 9.09 20 45.45 24.85 5
CoV2ID034 PCR primer reverse NIID_WH-1_Seq_R24865 CAAAGACACCTTCACGAGG 24830-24848 S CCTCGTGAAGGTGTCTTTG 31155-31173 5.26 0 51.88 19.05 5
CoV2ID035 PCR primer forward NIID_2019-nCOV_N_F2 AAATTTTGGGGACCAGGAAC 29125-29144 N AAATTTTGGGGACCAGGAAC 36993-37012 25 0 59.52 28.17 5
CoV2ID036 PCR primer reverse NIID_2019-nCOV_N_R2 TGGCAGCTGTGTAGGTCAAC 29263-29282 N GTTGACCTACACAGGTGCCA 37159-37178 10 0 45.48 18.49 5
CoV2ID037 Probe NIID_2019-nCOV_N_P2 ATGTCGCGCATTGGCATGGA 29222-29241 N ATGTCGCGCATTGGCATGGA 37090-37109 5 0 41.19 15.4 5
CoV2ID038 PCR primer forward CDC_2019-nCoV_N1-F GACCCCAAAATCAGCGAAAT 28287-28306 N GACCCCAAAATCAGCGAAAT 36045-36064 0 0 52.38 17.46 6
CoV2ID039 PCR primer reverse CDC_2019-nCoV_N1-R TCTGGTTACTGCCAGTTGAATCTG 28335-28358 N CAGATTCAACTGGCAGTAACCAGA 36093-36116 12.5 20 46.03 26.18 6
CoV2ID040 Probe CDC_2019-nCoV_N1-P ACCCCGCATTACGTTTGGTGGACC 28309-28332 N ACCCCGCATTACGTTTGGTGGACC 36067-36090 4.17 0 49.8 17.99 6
CoV2ID041 PCR primer forward CDC_2019-nCoV_N2-F TTACAAACATTGGCCGCAAA 29164-29183 N TTACAAACATTGGCCGCAAA 37032-37051 15 0 51.43 22.14 6
CoV2ID042 PCR primer reverse CDC_2019-nCoV_N2-R GCGCGACATTCCGAAGAA 29213-29230 N TTCTTCGGAATGTCGCGC 37081-37098 11.11 40 48.15 33.09 6
CoV2ID043 Probe CDC_2019-nCoV_N2-P ACAATTTGCCCCCAGCGCTTCAG 29188-29210 N ACAATTTGCCCCCAGCGCTTCAG 37056-37078 21.74 20 55.28 32.34 6
CoV2ID044 PCR primer forward CDC_2019-nCoV_N3-F GGGAGCCTTGAATACACCAAAA 28681-28702 N GGGAGCCTTGAATACACCAAAA 36439-36460 0 0 45.45 15.15 6
CoV2ID045 PCR primer reverse CDC_2019-nCoV_N3-R TGTAGCACGATTGCAGCATTG 28732-28752 N CAATGCTGCAATCGTGCTACA 36490-36510 0 0 44.67 14.89 6
CoV2ID046 Probe CDC_2019-nCoV_N3-P AYCACATTGGCACCCGCAATCCTG 28704-28727 N ATCACATTGGCACCCGCAATCCTG 36464-36485 0 0 41.13 13.71 6
CoV2ID047 PCR primer forward Pasteur_nCoV_IP2-12669Fw ATGAGCTTAGTCCTGTTG 12690-12707 ORF1ab ATGAGCTTAGTCCTGTTG 15917-15934 44.44 0 65.34 36.59 7
CoV2ID048 PCR primer reverse Pasteur_nCoV_IP2-12759Rv CTCCCTTTGTTGTGTTGT 12780-12797 ORF1ab ACAACACAACAAAGGGAG 16007-16024 11.11 40 49.74 33.62 7
CoV2ID049 Probe Pasteur_nCoV_IP2-12696bProbe AGATGTCTTGTGCTGCCGGTA 12717-12737 ORF1ab AGATGTCTTGTGCTGCCGGTA 15944-15964 4.76 20 42.86 22.54 7
CoV2ID050 PCR primer forward Pasteur_nCoV_IP4-14059Fw GGTAACTGGTATGATTTCG 14080-14098 ORF1ab GGTAACTGGTATGATTTCG 17334-17352 63.16 60 81.7 68.29 7
CoV2ID051 PCR primer reverse Pasteur_nCoV_IP4-14146Rv CTGGTCAAGGTTAATATAGG 14167-14186 ORF1ab CCTATATTAACCTTGACCAG 17421-17440 30 80 59.76 56.59 7
CoV2ID052 Probe Pasteur_nCoV_IP4-14084Probe TCATACAAACCACGCCAGG 14105-14123 ORF1ab TCATACAAACCACGCCAGG 17359-17377 15.79 40 51.38 35.72 7
CoV2ID053 PCR primer forward RBD-qF1 CAATGGTTTAACAGGCACAGG 23191 - 23211 S CAATGGTTTAACAGGCACAGG 29268-29288 38.1 40 63.49 47.2 8
CoV2ID054 PCR primer reverse RBD-qR1 CTCAAGTGTCTGTGGATCACG 23291 - 23311 S CGTGATCCACAGACACTTGAG 29383-29403 4.76 0 49.21 17.99 8
CoV2ID055 PCR primer forward ND-CoVs-951F TGTKAGRTTYCCTAAYATTAC 22540 - 22560 S TGTTAGATTTCCTAATATTAC 28195-28215 19.05 0 48.98 22.68 8
CoV2ID056 PCR primer reverse D-CoVs-1805R ACATCYTGATANARAACAGC 23387 - 23406 S GCTGTTCTTTATCAGGATGT 29479-29498 5 20 54.76 26.59 8
CoV2ID057 PCR primer forward nCoV_2019 Forward CAAATTCTATGGTGGTTGGCACA 15216 - 15238 ORF1ab CAAATTCTATGGTGGTTGGCACA 18473-18495 65.22 40 80.95 62.06 9
CoV2ID058 PCR primer reverse nCoV_2019 Reverse GGCATGGCTCTATCACATTTAGG 15298 - 15320 ORF1ab CCTAAATGTGATAGAGCCATGCC 18555-18577 69.57 80 87.58 79.05 9
CoV2ID059 Probe CoV_Probe ATAATCCCAACCCATRAG 15280 - 15297 ORF1ab CTTATGGGTTGGGATTAT 18537-18554 72.22 60 90.74 74.32 9
CoV2ID060 Target Generation N-gene-FWD IVT AATTCTAATACGACTCACTATAGGGCCAAATTGGCTACTACCGAAGAGCTAC 28519 - 28545 N CCAAATTGGCTACTACCGAAGAGCTAC 36277-36303 7.41 20 44.09 23.83 10
CoV2ID061 Target Generation N-gene-REV IVT CACAGTTTGCTGTTTCTTCTGTCTCTGCGG 29420 - 29449 N CCGCAGAGACAGAAGAAACAGCAAACTGTG 37350-37379 6.67 0 42.7 16.46 10
CoV2ID062 Target Generation E-gene-FWD IVT AATTCTAATACGACTCACTATAGGGCTGGTGTTGAACATGTTACCTTCTTCATC 26060 - 26088 E CTGGTGTTGAACATGTTACCTTCTTCATC 33630-33658 17.24 0 49.75 22.33 10
CoV2ID063 Target Generation E-gene-REV IVT CCTATTACTAGGTTCCATTGTTC 26574 - 26596 E GAACAATGGAACCTAGTAATAGG 34280-34303 29.17 0 60.91 30.03 10
CoV2ID064 LAMP outer forward primer F3 2019-nCoV N-gene AACACAAGCTTTCGGCAG 29083 - 29100 N AACACAAGCTTTCGGCAG 36951-36968 33.33 40 58.99 44.11 10
CoV2ID065 LAMP outer backward primer B3 2019-nCoV N-gene GAAATTTGGATCTTTGTCATCC 29290 - 29311 N GGATGACAAAGATCCAAATTTC 37215-37232 22.22 40 49.74 37.32 10
CoV2ID066 LAMP backward inner primer BIP 2019-nCoV N-gene TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC 29119 - 29137 N CCAAGGAAATTTTGGGGAC 37028-37049 18.18 20 56.06 31.41 10
CoV2ID067 LAMP forward inner primer FIP 2019-nCoV N-gene CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG 29269 - 29287 N CTACACAGGTGCCATCAAA 37096-37115 5 0 38.1 14.37 10
CoV2ID068 LAMP loop forward primer LF 2019-nCoV N-gene TTCCTTGTCTGATTAGTTC 29141 - 29159 N GAACTAATCAGACAAGGAA 37009-37027 15.79 40 51.13 35.64 10
CoV2ID069 LAMP loop backward primer LB 2019-nCoV N-gene ACCTTCGGGAACGTGGTT 29248 - 29265 N ACCTTCGGGAACGTGGTT 37151-37161 0 0 42.42 14.14 10
CoV2ID070 LAMP outer forward primer F3 2019-nCoV E-gene CCGACGACGACTACTAGC 26191 - 26208 E CCGACGACGACTACTAGC 33799-33816 0 0 40.21 13.4 10
CoV2ID071 LAMP outer backward primer B3 2019-nCoV E-gene AGAGTAAACGTAAAAAGAAGGTT 26402 - 26424 E AACCTTCTTTTTACGTTTACTCT 34064-34086 21.74 40 54.45 38.73 10
CoV2ID072 LAMP backward inner primer BIP 2019-nCoV E-gene ACCTGTCTCTTCCGAAACGAATTTGTAAGCACAAGCTGATG 26214 - 26233 E TTTGTAAGCACAAGCTGATG 33915-33936 0 0 29.22 9.74 10
CoV2ID073 LAMP forward inner primer FIP 2019-nCoV E-gene CTAGCCATCCTTACTGCGCTACTCACGTTAACAATATTGCA 26374 - 26394 E TGCAATATTGTTAACGTGAGT 34036-34056 4.76 0 43.08 15.95 10
CoV2ID074 LAMP loop forward primer LF 2019-nCoV E-gene TCGATTGTGTGCGTACTGC 26355 - 26373 E TCGATTGTGTGCGTACTGC 34017-34035 26.32 0 56.89 27.74 10
CoV2ID075 LAMP loop backward primer LB 2019-nCoV E-gene TGAGTACATAAGTTCGTAC 26235 - 26253 E GTACGAACTTATGTACTCA 33900-33915 0 0 29.46 9.82 10
CoV2ID076 PCR primer forward N_Sarbeco_F CACATTGGCACCCGCAATC 28706 - 28724 N CACATTGGCACCCGCAATC 36464-36482 0 0 39.85 13.28 11
CoV2ID077 PCR primer reverse N_Sarbeco_R GAGGAACGAGAAGAGGCTTG 28814 - 28833 N CAAGCCTCTTCTCGTTCCTC 36572-36591 20 0 56.9 25.63 11
CoV2ID078 Probe N_Sarbeco_P ACTTCCTCAAGGAACAACATTGCCA 28753 - 28777 N ACTTCCTCAAGGAACAACATTGCCA 36511-36535 0 0 50.48 16.83 11
CoV2ID079 PCR primer forward nsp2f ATGCATTTGCATCAGAGGCT 1866 - 1885 ORF1ab ATGCATTTGCATCAGAGGCT 2946-2965 0 0 37.62 12.54 12
CoV2ID080 PCR primer reverse nsp2r TTGTTATAGCGGCCTTCTGT 1951 - 1970 ORF1ab ACAGAAGGCCGCTATAACAA 3228-3247 0 0 41.19 13.73 12
CoV2ID081 PCR primer forward N_gene_Taq1 TCTGGTAAAGGCCAACAACAA 28976 - 28996 N TCTGGTAAAGGCCAACAACAA 36764-36784 0 0 32.65 10.88 13
CoV2ID082 PCR primer reverse N_gene_Taq2 TGTATGCTTTAGTGGCAGTACG 29057 - 29078 N CGTACTGCCACTAAAGCATACA 36919-36934 18.75 20 56.55 31.77 13
CoV2ID083 Probe N_gene_Probe CTGTCACTAAGAAATCTGCTGCTGAGGC 29007 - 29034 N CTGTCACTAAGAAATCTGCTGCTGAGGC 36839-36869 12.9 0 53.15 22.02 13
CoV2ID084 PCR primer forward orf1ab-F CAGACCTCGTCTATGCTTTAAGGC 13814 - 13837 ORF1ab CAGACCTCGTCTATGCTTTAAGGC 17068-17091 33.33 20 64.88 39.4 14
CoV2ID085 PCR primer reverse orf1ab-R CCCTGGTCAAGGTTAATATAGGCA 14165 - 14188 ORF1ab TGCCTATATTAACCTTGACCAGGG 17419-17442 33.33 100 62.1 65.14 14
CoV2ID086 PCR primer forward S-F CTTCCCTCAGTCAGCACCTC 24715 - 24734 S CTTCCCTCAGTCAGCACCTC 31031-31050 25 40 55.24 40.08 14
CoV2ID087 PCR primer reverse S-R AACCAGTGTGTGCCATTTGA 24815 - 24870 S TCAAATGGCACACACTGGTT 31193-31210 5.56 0 41.53 15.7 14
CoV2ID088 LAMP outer forward primer orf1ab-4F3 GGTATGATTTTGTAGAAAACCCA 13925 - 13947 ORF1ab GGTATGATTTTGTAGAAAACCCA 17179-17201 52.17 20 75.98 49.38 14
CoV2ID089 LAMP outer backward primer orf1ab-4B3 CAACAGGAACTCCACTACC 14122 - 14140 ORF1ab GGTAGTGGAGTTCCTGTTG 17376-17394 21.05 0 55.89 25.65 14
CoV2ID090 LAMP forward inner primer orf1ab-4FIP GGCATCACAGAATTGTACTGTTTTTGCGTATACGCCAACTTAGG 13958 - 13976 ORF1ab GCGTATACGCCAACTTAGG 17255-17279 16 20 52.19 29.4 14
CoV2ID091 LAMP backward inner primer orf1ab-4BIP AATGCTGGTATTGTTGGTGTACTGAGGTTTGTATGAAATCACCGAA 14095 - 14115 ORF1ab TTCGGTGATTTCATACAAACC 17286-17310 44 0 66.1 36.7 14
CoV2ID092 LAMP loop forward primer orf1ab-4LF AACAAAGCTTGGCGTACACGTTCA 13977 - 14000 ORF1ab TGAACGTGTACGCCAAGCTTTGTT 17231-17254 20.83 40 51.79 37.54 14
CoV2ID093 LAMP outer forward primer S-123F3 TCTATTGCCATACCCACAA 23693 - 23711 S TCTATTGCCATACCCACAA 29922-29937 37.5 20 60.71 39.4 14
CoV2ID094 LAMP outer backward primer S-123B3 GGTGTTTTGTAAATTTGTTTGAC 23915 - 23937 S GTCAAACAAATTTACAAAACACC 30159-30181 4.35 20 40.99 21.78 14
CoV2ID095 LAMP forward inner primer S-123FIP CATTCAGTTGAATCACCACAAATGTGTGTTACCACAGAAATTCTACC 23724 - 23745 S GTGTTACCACAGAAATTCTACC 30010-30034 28 40 55.43 41.14 14
CoV2ID096 LAMP backward inner primer S-123BIP GTTGCAATATGGCAGTTTTTGTACATTGGGTGTTTTTGTCTTGTT 23880 - 23899 S AACAAGACAAAAACACCCAA 30047-30071 28 0 58.86 28.95 14
CoV2ID097 LAMP loop forward primer S-123LF ACTGATGTCTTGGTCATAGACACT 23746 - 23769 S AGTGTCTATGACCAAGACATCAGT 29972-29995 4.17 20 46.63 23.6 14
CoV2ID098 LAMP loop backward primer S-123LB TAAACCGTGCTTTAACTGGAATAGC 23850 - 23874 S TAAACCGTGCTTTAACTGGAATAGC 30098-30118 9.52 20 48.98 26.17 14
CoV2ID099 PCR primer forward Chan_S_gene_F CCTACTAAATTAAATGATCTCTGCTTTACT 22712 - 22741 S CCTACTAAATTAAATGATCTCTGCTTTACT 28400-28429 10 0 50.63 20.21 15
CoV2ID100 PCR primer reverse Chan_S_gene_R CAAGCTATAACGCAGCCTGTA 22849 - 22869 S TACAGGCTGCGTTATAGCTTG 28538-28558 9.52 0 45.8 18.44 15
CoV2ID101 PCR primer forward Chan_RdRp_gene_F CAAGTGGGGTAAGGCTAGACTTT 14965 - 14983 ORF1ab TGGGGTAAGGCTAGACTTT 18222-18240 52.63 40 72.93 55.19 15
CoV2ID102 PCR primer reverse Chan_RdRp_gene_R ACTTAGGATAATCCCAACCCAT 15283 - 15302 ORF1ab ATGGGTTGGGATTATCCTAA 18540-18559 80 100 94.29 91.43 15
CoV2ID103 PCR primer forward Caly_BetaCoV_RdRp_F AAATTCTATGGTGGTTGGCACAACATGTT 15217 - 15245 ORF1ab AAATTCTATGGTGGTTGGCACAACATGTT 18474-18502 65.52 80 83.25 76.26 16
CoV2ID104 PCR primer reverse Caly_BetaCoV_RdRp_R TAGGCATAGCTCTRTCACAYTT 15301 - 15322 ORF1ab AAATGTGATAGAGCCATGCCTA 18558-18579 63.64 80 83.98 75.87 16
CoV2ID105 Probe Caly_BetaCoV_RdRp_P TGGGTTGGGATTATC 15284 - 15298 ORF1ab TGGGTTGGGATTATC 18541-18555 80 60 94.29 78.1 16
CoV2ID106 PCR primer forward Huang_E_gene_F ACTTCTTTTTCTTGCTTTCGTGGT 26295 - 26318 E ACTTCTTTTTCTTGCTTTCGTGGT 33957-33980 8.33 20 44.05 24.13 17
CoV2ID107 PCR primer reverse Huang_E_gene_R GCAGCAGTACGCACACAATC 26357 - 26376 E GATTGTGTGCGTACTGCTGC 34019-34038 20 20 51.67 30.56 17
CoV2ID108 Probe Huang_E_gene_P CTAGTTACACTAGCCATCCTTACTGC 26326 - 26351 E CTAGTTACACTAGCCATCCTTACTGC 33988-34013 23.08 0 50.73 24.6 17
CoV2ID109 PCR primer forward Lu_orf1ab_F AGAAGATTGGTTAGATGATGATAGT 3193 - 3217 ORF1ab AGAAGATTGGTTAGATGATGATAGT 4979-4993 0 0 32.38 10.79 18
CoV2ID110 PCR primer reverse Lu_orf1ab_R TTCCATCTCTAATTGAGGTTGAACC 3286 - 3310 ORF1ab GGTTCAACCTCAATTAGAGATGGAA 5087-5101 6.67 0 42.86 16.51 18
CoV2ID111 Probe Lu_orf1ab_P TCCTCACTGCCGTCTTGTTGACCA 3229 - 3252 ORF1ab TGGTCAACAAGACGGCAGTGAGGA 5005-5028 0 0 41.07 13.69 18
CoV2ID112 LAMP outer forward primer F3 2019-nCoV N1-gene TGGACCCCAAAATCAGCG 28285 - 28302 N TGGACCCCAAAATCAGCG 36043-36060 0 0 52.38 17.46 19
CoV2ID113 LAMP outer backward primer B3 2019-nCoV N1-gene GCCTTGTCCTCGAGGGAAT 28468 - 28486 N ATTCCCTCGAGGACAAGGC 36226-36244 0 0 52.38 17.46 19
CoV2ID114 LAMP forward inner primer FIP 2019-nCoV N1-gene CCACTGCGTTCTCCATTCTGGTAAATGCACCCCGCATTACG 28303 - 28321 N AATGCACCCCGCATTACG 36111-36132 9.09 0 51.3 20.13 19
CoV2ID115 LAMP backward inner primer BIP 2019-nCoV N1-gene CGCGATCAAAACAACGTCGGCCCTTGCCATGTTGAGTGAGA 28438 - 28457 N TCTCACTCAACATGGCAAGG 36135-36157 4.35 0 45.13 16.49 19
CoV2ID116 LAMP loop forward primer LF 2019-nCoV N1-gene TGAATCTGAGGGTCCACCAAA 28322 - 28342 N TTTGGTGGACCCTCAGATTCA 36080-36100 9.52 0 45.8 18.44 19
CoV2ID117 LAMP loop backward primer LB 2019-nCoV N1-gene GGTTTACCCAATAATACTGCGTCTT 28403 - 28427 N GGTTTACCCAATAATACTGCGTCTT 36161-36185 4 20 50.48 24.83 19
CoV2ID118 LAMP outer forward primer F3 2019-nCoV N15-gene AGATCACATTGGCACCCG 28702 - 28719 N AGATCACATTGGCACCCG 36460-36477 0 0 39.15 13.05 19
CoV2ID119 LAMP outer backward primer B3 2019-nCoV N15-gene CCATTGCCAGCCATTCTAGC 28895 - 28914 N GCTAGAATGGCTGGCAATGG 36674-36693 0 0 33.1 11.03 19
CoV2ID120 LAMP forward inner primer FIP 2019-nCoV N15-gene TGCTCCCTTCTGCGTAGAAGCCAATGCTGCAATCGTGCTAC 28732 - 28751 N CAATGCTGCAATCGTGCTAC 36539-36560 0 0 52.38 17.46 19
CoV2ID121 LAMP backward inner primer BIP 2019-nCoV N15-gene GGCGGCAGTCAAGCCTCTTCCCTACTGCTGCCTGGAGTT 28864 - 28883 N AACTCCAGGCAGCAGTAGGG 36563-36582 15 0 50.95 21.98 19
CoV2ID122 LAMP loop forward primer LF 2019-nCoV N15-gene GCAATGTTGTTCCTTGAGGAAGTT 28752 - 28775 N AACTTCCTCAAGGAACAACATTGC 36510-36533 0 0 50 16.67 19
CoV2ID123 LAMP loop backward primer LB 2019-nCoV N15-gene GTTCCTCATCACGTAGTCGCAACA 28827 - 28850 N GTTCCTCATCACGTAGTCGCAACA 36617-36629 15.38 20 52.38 29.25 19
CoV2ID124 LAMP outer forward primer F3 2019-nCoV S17-gene TCTTTCACACGTGGTGTT 21653 - 21670 S TCTTTCACACGTGGTGTT 25936-25948 0 0 28.57 9.52 19
CoV2ID125 LAMP outer backward primer B3 2019-nCoV S17-gene GTACCAAAAATCCAGCCTC 21867 - 21885 S GAGGCTGGATTTTTGGTAC 5862-5876 60 40 81.59 60.53 19
CoV2ID126 LAMP forward inner primer FIP 2019-nCoV S17-gene CATGGAACCAAGTAACATTGGAAAACCTGACAAAGTTTTCAGATCC 21677 - 21697 S CCTGACAAAGTTTTCAGATCC 26082-26104 0 0 39.75 13.25 19
CoV2ID127 LAMP backward inner primer BIP 2019-nCoV S17-gene CTCTGGGACCAATGGTACTAAGAGGACTTCTCAGTGGAAGCA 21838 - 21855 S TGCTTCCACTGAGAAGTC 26382-26399 0 0 29.37 9.79 19
CoV2ID128 LAMP loop forward primer LF 2019-nCoV S17-gene GAAAGGTAAGAACAAGTCCTGAGT 21713 - 21736 S ACTCAGGACTTGTTCTTACCTTTC 26031-26056 0 0 29.85 9.95 19
CoV2ID129 LAMP loop backward primer LB 2019-nCoV S17-gene CTGTCCTACCATTTAATGATGGTGT 21807 - 21831 S CTGTCCTACCATTTAATGATGGTGT 26351-26375 0 0 34.1 11.37 19
CoV2ID130 LAMP outer forward primer F3 2019-nCoV O117-gene CCCCAAAATGCTGTTGTT 1346 - 1363 ORF1ab CCCCAAAATGCTGTTGTT 2241-2258 0 0 32.28 10.76 19
CoV2ID131 LAMP outer backward primer B3 2019-nCoV O117-gene TAGCACGTGGAACCCAAT 1530 - 1547 ORF1ab ATTGGGTTCCACGTGCTA 2521-2533 0 0 37 12.33 19
CoV2ID132 LAMP forward inner primer FIP 2019-nCoV O117-gene GGTTTTCAAGCCAGATTCATTATGGATGTCACAATTCAGAAGTAGGA 1381 - 1402 ORF1ab TGTCACAATTCAGAAGTAGGA 2276-2295 0 0 30.24 10.08 19
CoV2ID133 LAMP backward inner primer BIP 2019-nCoV O117-gene TCTTCGTAAGGGTGGTCGCAGCACACTTGTTATGGCAAC 1509 - 1527 ORF1ab GTTGCCATAACAAGTGTGC 2409-2428 10 20 47.62 25.87 19
CoV2ID134 LAMP loop forward primer LF 2019-nCoV O117-gene TCGGCAAGACTATGCTCAGG 1403 - 1422 ORF1ab CCTGAGCATAGTCTTGCCGA 2352-2367 6.25 0 51.49 19.25 19
CoV2ID135 LAMP loop backward primer LB 2019-nCoV O117-gene TTGCCTTTGGAGGCTGTGT 1476 - 1494 ORF1ab TTGCCTTTGGAGGCTGTGT 2432-2450 10.53 20 43.86 24.8 19
CoV2ID136 LAMP outer forward primer F3 2019-nCoV orf1ab-gene AAACGTAATGTCATCCCTACT 15034 - 15054 ORF1ab AAACGTAATGTCATCCCTACT 18291-18311 61.9 60 80.73 67.54 20
CoV2ID137 LAMP outer backward primer B3 2019-nCoV orf1ab-gene ACTGTTTATAGTGATGTAGAAAACC 15250 - 15274 ORF1ab ACTGTTTATAGTGATGTAGAAAACC 18507-18531 36 20 61.71 39.24 20
CoV2ID138 LAMP forward inner primer FIP 2019-nCoV orf1ab-gene ACAGATAGAGACACCAGCTACGGCTCAAATGAATCTTAAGTATGCCA 15059 - 15082 ORF1ab CTCAAATGAATCTTAAGTATGCCA 18316-18339 66.67 80 83.93 76.87 20
CoV2ID139 LAMP backward inner primer BIP 2019-nCoV orf1ab-gene ATAGCCGCCACTAAGAGGAGCCCAACCACCATAGAATTTGC 15215 - 15234 ORF1ab CAAATTCTATGGTGGTTGG 18472-18491 70 40 85.24 65.08 20
CoV2ID140 LAMP loop backward primer LF 2019-nCoV orf1ab-gene TTAGTGCAAAGAATAGAGCTCGCA 15083 - 15106 N TTAGTGCAAAGAATAGAGCTCGCA 18340-18363 45.83 40 76.79 54.21 21
CoV2ID141 LAMP outer forward primer F3 2019-nCoV N-gene GCCAAAAGGCTTCTACGCA 28774 - 28792 N GCCAAAAGGCTTCTACGCA 36532-36550 0 0 52.38 17.46 21
CoV2ID142 LAMP outer backward primer B3 2019-nCoV N-gene TTGCTCTCAAGCTGGTTCAA 28952 - 28971 N TTGAACCAGCTTGAGAGCAA 36740-36759 10 20 45 25 21
CoV2ID143 LAMP forward inner primer FIP 2019-nCoV N-gene TCCCCTACTGCTGCCTGGAGCAGTCAAGCCTCTTCTCGTT 28809 - 28829 N GCAGTCAAGCCTCTTCTCGTT 36567-36587 19.05 20 55.33 31.46 21
CoV2ID144 LAMP backward inner primer BIP 2019-nCoV N-gene TCTCCTGCTAGAATGGCTGGCATCTGTCAAGCAGCAGCAAAG 28932 - 28952 N CTTTGCTGCTGCTTGACAGAT 36668-36689 0 0 39.39 13.13 21
CoV2ID145 LAMP loop backward primer LB 2019-nCoV N-gene TGGCGGTGATGCTGCTCTT 28912 - 28930 N TGGCGGTGATGCTGCTCTT 36691-36709 5.26 0 43.36 16.21 21